SimpleSearch - Line and FST details


Line specific information

 
Line ID 387G01
Vector Used pAC161
Line Availability only available from NASC (N437129)
Segregation Analysis 50:48:47
Confirmed for Hit At4g38160
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g38160

 
Sequence (A. th genome BLAST matches underlined)
>07-K018254-022-387-G01-8409
TGATCCTGAAATTTCCCGGACTGAAGCCTTTACATTGAATATATCCTGTCCGGTGATTGA
ATATTCCTCTGTAGAGTAAATGACTGATATATCCATCAGTCCTTCTCGCGGGACTAAACC
CTCCTCTTCTCCTGTCTACGTCAAAATCTGCTCAACCCTAACTTTTCGAATCATCGGCAA
ATGACGATTGTGCCGTCCTCCGAAGCCGTCGTTTTTGCAAGGCAGATTGCGAATCATATG
CTTGTTACGACGCCATCTATGTCCGCTACACGCTATCTGTCAACGGGCGACAATGGTTCA
GTACACTAGCAGCACAAACCTCCGGAACCCTTACACTACCAATGCTTGCAAGGGGAAAGA
TCTTCTCCCTCTCATCGAGAATCACCCCCTCTGGGATCCACCTTATCGCGAGAATGAGAG
ACTCATCCCGATGGTCGAGTGCCTCTCCAGTCTTGGAAGGAATCCTCGGGAAGTTGCTTC
CGCCATTACCAAATTTCCTCCAATACTCTCTCANAGCGTGGAGGAGAAACTCTGTCCCCT
TCTTGCTTTCTTTCAAGCGTTAGGTGTGCCTGAGACTCAACTTGGCAAAATGATACTTTT
TAACCCAAGGCTTATCANCTACCGCATCGACCCCCAGCTGACNGTGATCGTTCAGCTTTC
TTGCTATGGG
GenBank Accession BX286019 [GenBank]
Graphic View Graphic view of gene At4g38160
Predicted Position of Insertion Chr4:17902280 - go to primer design
BLAST e Value 2e-123
Hit Clone Code (BAC ID) F20D10
Hit Gene Code At4g38160 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mitochondrial transcription termination factor family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX286018 [GenBank]


Last Updated on 14.10.2014 10:23