SimpleSearch - Line and FST details


Line specific information

 
Line ID 389A01
Vector Used pAC161
Line Availability only available from NASC (N437249)
Segregation Analysis 50:50:41
Confirmed for Hit F21B23
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F21B23

 
Sequence (A. th genome BLAST matches underlined)
>01-K018268-022-389-A01-8409
TGATCTGTAGATTTCCCGGACATGAAGCCATTGTCAATTGAAGCCATGTAGATAGAGAAA
GGAAGAAAGGTGAGAAAGGGAGATTTAGAAAAAGGAAACAAGAGAGAGAGAAAGGTGAGG
AAGAGATATCAGAAAAGAGGTAAACGAGAGAAAAAGAGAAAGGTAAGAGAGAGATAGAAG
AAGAACATAAGCTTAGATATCAACAATAACGAAAAACAATTAAGATGGACTCTTTTAAGC
TCTGAATGACAATGTAAAAGCATCTTATGATCATTGAGTTAGGAAAAAAGAGTGTTATGT
GAAACCTTAATTTGCATTCGACCACAATTTATTTAAAATACATAATACTTTTAAGTTCAA
AACGATATTTGTACAAACATGATCACACACAAACGCATTCACCTCCCCATAACCCTTTTT
CGTTGTCTCACTTGGGTGTGAAAGCCTGTAAAAAAACACAAAAGCTATGGGATCCCCC
GenBank Accession BX286140 [GenBank]
Graphic View Graphic view of sequence BX286140 of line 389A01
Predicted Position of Insertion Chr5:10372609 - go to primer design
BLAST e Value 2e-147
Hit Clone Code (BAC ID) F21B23
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX286140 [GenBank]

Gene hit At5g42970

 
Sequence (A. th genome BLAST matches underlined)
>01-K017791-022-389-A01-8409
AGTAGGACTTCTTCGGAATACGTTACATCGTATATTATTGCTGCCTATGGGATCCTCCCT
ATAGTGAGATCCTCACCATACAAGAGAATCACAGCCTCCTCCTGAACAGTAACATAAAAT
ATTAAAACACGCCTATGGGATCCTCCCTATAGTGAGCAAGGTTAGACATCTTGGAGATTA
TAATGATATAAAACAACAAACAATATTACATAAAGCCACCTCCATAAACTAAACACCTAA
ACATACACCAAAA
GenBank Accession BX286138 [GenBank]
Graphic View Graphic view of gene At5g42970
Predicted Position of Insertion Chr5:17237609 - go to primer design
BLAST e Value 3e-17
Hit Clone Code (BAC ID) MBD2
Hit Gene Code At5g42970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Proteasome component (PCI) domain protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 31.08.2016 09:40