SimpleSearch - Line and FST details


Line specific information

 
Line ID 389C02
Vector Used pAC161
Line Availability only available from NASC (N437274)
Segregation Analysis 50:41:39
Confirmed for Hit At4g37270
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g37270

 
Sequence (A. th genome BLAST matches underlined)
>11-K018268-022-389-C02-8409
TTCCCGGACTGAAGCCTGTATGATGGCTTCAAAAAAATGTTTACTTTTGGGGAACTTTCT
TCTTATTGTTGAGACCATGGACTCTCCTTGCAGTATTCTCGGATATAGGGTGGGTTGGTC
TATTCCGTAAACATCTTGTTTAGCCTGGCGAAATGTGCTGGCTCAAGCAATCTATGGGAT
CCTGCCCTATATGGAGATGATGATGAATGAATGGCGCATATGCTACGCCATCGTCATATC
TATGAACACCTCCATATTGCCACTAACTATTGGATATCATTTTCCTTTTGTCCATATCCC
GTTGAAAACGTGGTTTATTTTCTTTTTCCTTTTTTTTTGCTATGTAAAGGTAGTATCTTC
ACGTGTAAGTGTGTAACCCCACCGTGTGTAACTATAATAGGGAATATTGCTAAAAGGTGC
ACAGGTTCTATGGGAT
GenBank Accession BX286189 [GenBank]
Graphic View Graphic view of gene At4g37270
Predicted Position of Insertion Chr4:17544478 - go to primer design
BLAST e Value 3e-51
Hit Clone Code (BAC ID) AP22
Hit Gene Code At4g37270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation heavy metal atpase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T28I19

 
Sequence (A. th genome BLAST matches underlined)
>11-K018261-022-389-C02-8409
ATTTCCCGGACTGAAGCCTTTACATTGAAACCAAAATTGGCTTTGAGTTTTTTGACAACT
CAATTATTGGGTACAGATTGAAACAATTGTATTTTGTTTTCCCAAAAAAGCAAATAATTA
GCCAAAAAAGAAACAAAAACATTGGGAACAAGGAAAAAAATAGTGGGTAAAAAGGTAAAT
TTGGGTAAGATGTGGTGAATAAATGAAGTAGGAGGACATTGGGTGGCGTGTGGGAGGATG
TGGGACACATGAAGAGTGTCGACATGATAGGTGAGAGATATGATACTAGATAGGTTCTTT
AGTCTTAGGGTTAGACTTTTGTGACTTTTGTTAGACACCTACCTAAGTGGTTTTGTCGTC
AAATCTGTTTTTAGGACTTTGGTTTTGGGTAACAATTTTAATCATAGCCTATAAAGCTCA
TGCTCTACTCTACTATACACATGTGAACTCATCTTATGGAATTTCCTCTCTTTGTCATCA
GGTGCGCCGAGTCCATTTATGCCTATCGGATCCTCCCGGGTCAATAGAGACAAAAAAAGG
GCGTCATTCCCACTTTTTTTCCTTTCGGAAGGGGGGAACACCCCCACCCCTTTTATATTT
TCAACGAATTTTTTATAAAAACGACAA
GenBank Accession BX286188 [GenBank]
Graphic View Graphic view of sequence BX286188 of line 389C02
Predicted Position of Insertion Chr4:17730593 - go to primer design
BLAST e Value 8e-144
Hit Clone Code (BAC ID) T28I19
Insertion Classification Genome Hit
Confirmation Status unknown
Other FSTs Supporting this Hit BX286188 [GenBank]


Last Updated on 31.08.2016 09:40