SimpleSearch - Line and FST details


Line specific information

 
Line ID 389C06
Vector Used pAC161
Line Availability only available from NASC (N437278)
Segregation Analysis 50:49:49
Confirmed for Hit At3g62190
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g62190

 
Sequence (A. th genome BLAST matches underlined)
>43-K018261-022-389-C06-8409
GAGACTATGGGATCCTCCGTATATTGAGGGAAAATGGAGGTGGAGGAAGCCAAGATCTTG
CTCGGCTTTCCTCCTGGTTCTCGTCCCGATCCTTCTCAGGGTTCTTCTTCTCTTCTTTTT
CGATTACAGTCGTTTGTGAGTTTCTCCGCGAGATTTTCGATCACTGAATTCGATCAATTA
GGGTTTTTGAATCTATCTGTCTTTTGAATTTGAGAGCTGAAATGGGTCGATTATAGACTC
GAATTTGGTGATGTCAATTTTAGTTGAATCGATGGTATATCCACAAGTTTTGTTTGTTAG
GTATGGGAATTGCGAGGGAGATTGGTGGATTTATTTTAATACATGTGCTGATATGAATCG
ATGATACGCTACCGCTGCTTACATGAAGAAAGGATGGGAATCGCATCCTGACTTATTTCC
TGATGATCAGAAGCTAGATGCCAAGTCTAAGTT
GenBank Accession BX286197 [GenBank]
Graphic View Graphic view of gene At3g62190
Predicted Position of Insertion Chr3:23021113 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T17J13
Hit Gene Code At3g62190 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chaperone DnaJ-domain superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23