SimpleSearch - Line and FST details


Line specific information

 
Line ID 393A09
Vector Used pAC161
Line Availability only available from NASC (N437641)
Segregation Analysis 50:50:45
Confirmed for Hit At2g26310
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g26310

 
Sequence (A. th genome BLAST matches underlined)
>65-K018292-022-393-A09-8409
AGATATCGTCCCTATTGATGAGACAGAGTGAGTAATAATTATGAAGCTTCCTTCTCTATG
CAATTTATTGAATACCTGACCTGAACATGGACAACGTTTGCAGTTGGTGGTAACCTGATT
GGAGCTGTCCGAAGCAAGGATCTTTGCAGTTAGTTCTTCATTCTAATTATTTGTTTTCTC
GTTTTTGTTTGCGTACTAAAAGTCCAAGGGCTCTGAGATTTGTGTACATTGCAGGAGCAT
TTTTTGGTATGTACATTGGAGATGTTCCGGTGTCAGAGCAGACAAAGGAGGAGATTGGTA
GAAAAGTGGTGGGAATCATAAAGAGATGCTGAAATCAATTACTTGTTAGATTTCCAATTG
CCTCTGAGTTTTAGAAGAAGGCAATTGGGTTAGATTTACGCGGTCATGCCTATGG
GenBank Accession BX286690 [GenBank]
Graphic View Graphic view of gene At2g26310
Predicted Position of Insertion Chr2:11203570 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T1D16
Hit Gene Code At2g26310 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chalcone-flavanone isomerase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23