SimpleSearch - Line and FST details


Line specific information

 
Line ID 393B06
Vector Used pAC161
Line Availability only available from NASC (N437650)
Segregation Analysis 50:50:38
Confirmed for Hit At1g27130
Parent of DUPLO pair none
Parent of pair(s) 4813, 4888, 4919, 8536, 10102, 10134, 91105
Note Although the line exists, the insertion in At5g27380 can not be ordered because the confirmation of this insertion failed.

Gene hit At5g27380

 
Sequence (A. th genome BLAST matches underlined)
>42-K018296-022-393-B06-8409
TGATCTGACATTTCCCGGACATGAGCCATTTACATTGATCATATTCTCTCCACAACGACC
TCTTCACAATGTGGCATACTTGACGGCAACTTACTGATTCTCACAGATGACCATTACGAG
TATATCCACACCTGAGATATCCCACTGCGAATGCTTGTCCGCCCCTGCAACAATGAAATC
TCTTAAATTAGCTCTCAAGATGAAGGTGTAACTTCTCAAAAGACCACAATGCACACTCCT
GCTTACACACATAAGGGTTTCATCCTCCTTCGCAATCCCTTCTTTTTCGACTTCTGCTAT
GGGATCCCCCTTTTCCGTGAGACGCCATTTTCCCTTCGTCGTCTTTTGCTCCGACCACCG
CATCCTCCGCCGCANAACACTGTTTCATAAACATAAGACAAAACCCTTGAGATGACTAAT
CTATGGGATCTCCNNNTATAGTGAGANGAACGGAACCCTCCCTTAAACTGAGTCTTTGAT
ATTCTCTGGATAAACAAGCCACGTCGTGCTCCACCATGGTGAACGAAAATTTTACTTCTT
GGCATTGAGTCGCATCAGACTCTGTATGGAGCCGAACGCCAGTCTTAACGGGCAAGTTCT
GGGGAGGTCCTCTATTTGAATCTGTGACTCCTTGGGAAATGGGGGAACCTCTA
GenBank Accession BX286704 [GenBank]
Graphic View Graphic view of gene At5g27380
Predicted Position of Insertion Chr5:9669090 - go to primer design
BLAST e Value 3e-48
Hit Clone Code (BAC ID) F21A20
Hit Gene Code At5g27380 [TAIR] [MIPS] [SIGnAL]
Gene Annotation glutathione synthetase 2
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 393B05

Gene hit At1g27130

 
Sequence (A. th genome BLAST matches underlined)
>42-K018292-022-393-B06-8409
TGATCTGTNATTTCCCGGACATGAAGCCATTTACATTGAATATATCCCGGACAACGACCT
CTGCAACGGATGGCATGGACGGGCTTAACACCTTCTTGGGCCCGAAACCTCTCGGTCCAT
TTGATCAACCCAGGTGTTGTCTCTTGCCGGAGAAACTTGACGCCGGATAACGCCTCGATC
ACGGAGATCGGACCTAATACAGCCGAACTAGCAATGTCGAGGGAGCCGATGGTCTCTCCT
CCAAAGAACCCTAATCCTTTGCTGCTCTTCTGAAACGTTTCTTCGAGTATCGCCAAACAC
TCCATCAGCTTTCCCACCGCCGCCTGTTTCCCTTCGTCGTCTTTTGCTCCGACCACCGCA
TCCACCGCCGTAAAACGCTGTTTCATAAGCCTAAGACAGAACCCTTGAGATGACTAACCT
ATGCGGTCCTGGGCGATTCTCAGAAAGCATTTCCTTGCAGCATATGGG
GenBank Accession BX286703 [GenBank]
Graphic View Graphic view of gene At1g27130
Predicted Position of Insertion Chr1:9426565 - go to primer design
BLAST e Value 3e-146
Hit Clone Code (BAC ID) T7N9
Hit Gene Code At1g27130 [TAIR] [MIPS] [SIGnAL]
Gene Annotation glutathione S-transferase tau 13
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23