SimpleSearch - Line and FST details


Line specific information

 
Line ID 393C06
Vector Used pAC161
Line Availability only available from NASC (N437662)
Segregation Analysis 50:49:19
Confirmed for Hit At2g04270
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F1O13

 
Sequence (A. th genome BLAST matches underlined)
>43-K018296-022-393-C06-8409
TGTCATGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATCCCGTAAACGAGG
GTCGGCAAGGAGCTATACACTGCTAGACTGACACTAACCAATCATCCATGAGTATGATGG
AGCCTCACCGTCCTCTTTGGAGAGCCTCCCTATCATAAGTATCCGTCGGTTCCTTTTGTT
TCTATTACGATACGGTGCTACTCGTTATGAAAATCCTTATACATCTCTACTTATGGTCCC
TACGGCTTATGTGAAACTACACATACGATCACCATGACTTTAGCTTCCCCTTCATTATCA
TTTTCCGTAAGATACATTGAGATTGCGCGATCTGGCTCCTAACTAGCTGATGCAAAATGA
TCTCCAGTAGCTTCTACATGTTCATTGGCTGCCCGAGCAACTTCCCTTTCCAAACTACCT
GACATATCCCATTGAGACGGTTATAGCATCTCCCAAAATACCGAGAAAAATCATTATTTA
AGAAAGATTGATGTTTGAGGTAAGCTTTTTATTTTGGCAGCCGAGGTTAACCTCTATGGT
ATCTCCCCTATGGGGAGATGAAACATCTATGGGATC
GenBank Accession BX286715 [GenBank]
Graphic View Graphic view of sequence BX286715 of line 393C06
Predicted Position of Insertion Chr2:1742750 - go to primer design
BLAST e Value 1e-31
Hit Clone Code (BAC ID) F1O13
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g04270

 
Sequence (A. th genome BLAST matches underlined)
>43-K018292-022-393-C06-8409
TGATCTGAAATTTCCCGGACTGAAGCCATTTACATCCGATGAAGATCCTATCCAGCTTTT
AACAGATAATTATACCTGAAATTTACACCAGAAGCAATCTGCCAAGCATATTAAGTTAAA
AGCAAACACGACATCTGAACTCACTTTCAAGAATTGAGGTTGGTTCCTTTTGTTACTACG
ACTGAAACGGTCAAACGTTTTATGTAAATTAAGATACATCTCTACTTATGTTCGCTACGG
CTTAAGTGAAACAAAAGAATAGATTACCTTGACTTTAGCTTCCCATTCATTATCATTTTC
CGTAGGATACATTGAGATTGCGCAGTCTGGCTCCCAGCTACCTAATGTAGAAGGATCTCC
AGTAACGTAGAGATGTTCATTGGCTGCCAGATCAACTTCCACAATCCAAACGACCTCGCA
TAATCCTTTGAGACGACTATGGGATCCTCCCTATAGTGAGAAAAATCATTATTTAAGAAA
GATTGATGTTTGAGGAAAGCTTAATATTG
GenBank Accession BX286714 [GenBank]
Graphic View Graphic view of gene At2g04270
Predicted Position of Insertion Chr2:1476017 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T23O15
Hit Gene Code At2g04270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNAse E/G-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40