SimpleSearch - Line and FST details


Line specific information

 
Line ID 395B10
Vector Used pAC161
Line Availability only available from NASC (N437846)
Segregation Analysis 50:50:47
Confirmed for Hit At5g56610
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g56610

 
Sequence (A. th genome BLAST matches underlined)
>74-K018298-022-395-B10-8409
GAAGTCTTGATCGGTTTATCGATATGCTTCACCAAAGAGACAATCGTATAACGAAGATGA
AAACATGATCTTTTTGTGTGTTTGATTCTTTAATACAGAGTCTATGGGATCCTCCCTATA
GTGAGAGAGGAGGAGANNACGNATTCTCNTTCGGTTATCGATTCATAAACGGAGATGCCT
TCACCGGGCAATGGGGATGTAAGTACATCTTGTTCACGAGACATGCCACGATCCCGCGAA
TGTATNGGCCATGGCTATAAACGATTTATTCTACTGCGGAAACCTTTAGTGCGACGGGGC
TACTTTCACGTCCCAATGGGGGCTTAGATGA
GenBank Accession BX286918 [GenBank]
Graphic View Graphic view of gene At5g56610
Predicted Position of Insertion Chr5:22917906 - go to primer design
BLAST e Value 3e-51
Hit Clone Code (BAC ID) MIK19
Hit Gene Code At5g56610 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Phosphotyrosine protein phosphatases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g56660

 
Sequence (A. th genome BLAST matches underlined)
>74-K018294-022-395-B10-8409
GTTTGTGCTTCTGAATCGGAACTATTAACCGATGAACAACCTGTCTACCGCATAGGTTGA
GAGTTCGTCATGAAAGCCTGCGACTGAACCTTTAGAAACCTTCTCTAATGAGGTACTGTA
CTGCGATCGATGTTTGGATTGCAGGTCCGCATTGAAGCACATCCGCGGGGATTCTATAGA
GTGTTGACTGAGACAATGCATACCCGCTGGTCTCATCTTGCATTCCCAGTAGAGAGAAAT
GGCCCGGGATTGTTTCTGCAAAGTATGAGAAGTCTTCGGATCCCATTACAGGTGCTGCTT
CCACAAAAGCTTCTTGACCCAACGAATCTCTAACCACCTTCTTGAATTGCTTGTACAAGT
CCTTGTTGTTCACTGTTGGTGGCATTGGTTCTCTACCGTTTGGTGTTAGATTAACGGACG
CATTGCATCCGGGAACGGCTGCTTGCTTGGTTATCCCCTATGGGATCCCCCCTATAATGA
GGAAACCGAGCACAAATTAACCCCGCGCCTATAACCCCCCACCCTCGTCGAGAAAAATGG
CGAGACAAACGTCAGAGACATGATAATAGTTTATTTCAA
GenBank Accession BX286917 [GenBank]
Graphic View Graphic view of gene At5g56660
Predicted Position of Insertion Chr5:22935130 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MIK19
Hit Gene Code At5g56660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation IAA-leucine resistant (ILR)-like 2
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 07.07.2016 14:03