SimpleSearch - Line and FST details


Line specific information

 
Line ID 396D09
Vector Used pAC161
Line Availability only available from NASC (N437965)
Segregation Analysis 50:47:31
Confirmed for Hit At4g02420
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At4g02410 can not be ordered because the confirmation of this insertion failed.

Gene hit At4g02410

 
Sequence (A. th genome BLAST matches underlined)
>68-K018295-022-396-D09-8409
GCATCTCCCNTTAATACTGTAGCACTTGTCTCATTGTTGGCCTATGGGATCCTTCGTATA
GAGAGCACAACAAACCTATGGGATCCTCCCTATAGAGATGATTTTTGAGCATACTGAGAC
CCTATGGGATCCTCCCTATAGTAGAGAAGTCACTTACATGTGTGACCGGTTCCCAATGTA
CGGTTTTGGGTTCCCAATGTACGGGTTCCGGTTCCCAATGAACGGCTTTGGGTTCCCAAT
GTACCTGCTATCCACAGGAAAGAGACCTTTTCGACCTTTTTCCCCTGCTAGGGCAATTTG
CCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession FR809511 [GenBank]
Graphic View Graphic view of gene At4g02410
Predicted Position of Insertion Chr4:1060222 - go to primer design
BLAST e Value 1e-07
Hit Clone Code (BAC ID) T14P8
Hit Gene Code At4g02410 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Concanavalin A-like lectin protein kinase family protein
Insertion Classification CDSi
Confirmation Status failed

Gene hit At4g02420

 
Sequence (A. th genome BLAST matches underlined)
>10-K118779-0022-396-D09C-8409
GCATTTCATTGAATATTCCACACGGGTCTAATGAGTCGGGCATGTTTACCAGTGGATCTT
CTGTTGCTTATTCTCTACTCTCCAGTGGGAGGTGATTTTCGTATACCATAACGTTTGTAG
AAAGCAATTATCTGCAAAAGATAGAGGACCATGAACTCAAACGTGAAATATTTGAAACTC
TAACGTTTAGTTTTATTGTTGCTGCATTGAAAGTGTATGGTTATCGAAGTATAATTATGT
ATCACATGGCTTTTCGATTAATAGTGTTTCCTAAGAGCATGTCCATTGCAGAGACCTTAC
AAGTTTCTTAAGAGAATCCTAATGAAAAGAAGCAAAAAAATAAATTAAAATTGTCTAATT
AACCAAGGTGCGAACCTTAAATAAGGTATTTTTGGGTGAGTAAGGTTCGCTGACGTGGCA
CTATATCATTGGAGGACCAA
GenBank Accession HG968952 [GenBank]
Graphic View Graphic view of gene At4g02420
Predicted Position of Insertion Chr4:1064441 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T14P8
Hit Gene Code At4g02420 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Concanavalin A-like lectin protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23