SimpleSearch - Line and FST details


Line specific information

 
Line ID 398G03
Vector Used pAC161
Line Availability only available from NASC (N438187)
Segregation Analysis 50:50:47
Confirmed for Hit At1g64440
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g64440

 
Sequence (A. th genome BLAST matches underlined)
>23-K017892-022-398-G03-8409
TCCATACAACATCGCTATAGCAGTATGTGTTATTTATTACAGAGATTATGATTTAGGTTC
ATAACATCTATACAACAGAATATCACCTATGGGATCCTCCCTATAGTGAGAGAGACTCTT
CTGTACAAGGACCCTCCTTTGGCCAGCCATACACAGTAGCGGTCGACGACCATACAAGCT
GATTGAGATCAATGAGAGAAAGAGAAATCATGTCTCACTGTCACATACTCACGTACATAA
GGAATACCAATTATCTGCACTACAGACCAGAAGGGGATTTTACCTTTCTACCTCCGCGTG
CGGGGGTTACTTCCAAAAGAGTAACAGTCGCAATCGGGTTATTGCTATAATACAGAAGGG
GTTTCGCCACGCTCTCACCAACTGCTTTCAATCCAGCAAAATGCATTACTGCATCAAACC
TATGGGATCCTCGCTATAGT
GenBank Accession BX287257 [GenBank]
Graphic View Graphic view of gene At1g64440
Predicted Position of Insertion Chr1:23938254 - go to primer design
BLAST e Value 2e-113
Hit Clone Code (BAC ID) F15H21
Hit Gene Code At1g64440 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD(P)-binding Rossmann-fold superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03