SimpleSearch - Line and FST details


Line specific information

 
Line ID 399F01
Vector Used pAC161
Line Availability only available from NASC (N438269)
Segregation Analysis 50:31:26
Confirmed for Hit At4g03390
Parent of DUPLO pair 2483
Parent of pair(s) none

Gene hit At4g03390

 
Sequence (A. th genome BLAST matches underlined)
>06-K017932-022-399-F01-8409
GATCCTGTAGATTTCCCGGACATGAAGCCATTTACAATTGGATATCAGCAAAGTGTGACA
ATGACTTTGCAGGGTATTGTCCATTAAGAGATGGATCAACCATTTTGCCCAATGCATCGA
TATCATGAAGCTGTGGGATTGCCCACCTCACCAAGAACTGCTCTCCTCTACTCCGGTCCC
TATAATCGACTCGTTGATATGAATAAATGCTTAACCGGAAACAGAAAACTAAGCAAATAA
AACAATGTGACATGCATACCTATCGTAGGACATTCTACCCGTCAATAGTTCTAACATAAC
AACACCAAAACTATATACATCACTCTGCCATGTATAGATTCCAGAGTCGAACTCTGGAGC
TCCATATCCGTAAGCGGCTATGGGATCCCCTTAATAGTGAG
GenBank Accession BX287335 [GenBank]
Graphic View Graphic view of gene At4g03390
Predicted Position of Insertion Chr4:1491119 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F4C21
Hit Gene Code At4g03390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation STRUBBELIG-receptor family 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX287334 [GenBank]


Last Updated on 31.08.2016 09:40