SimpleSearch - Line and FST details


Line specific information

 
Line ID 399F09
Vector Used pAC161
Line Availability only available from NASC (N438277)
Segregation Analysis 50:43:31
Confirmed for Hit At4g36480
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g36480

 
Sequence (A. th genome BLAST matches underlined)
>70-K017893-022-399-F09-8409
TGATCTGANATTTCCCGGACATGAAGCCTTTACAATTGAATATATCCATATTGTTTTCTT
AAAATTAGAGAAATCTAGCGGTTCAGCTAAAGATGATTTGCTTCTACTTGAGAAAATGGC
TGACCGTGTAAGTTCATTGTTTCTTTGCAAAACCAAATCTAGACCCTGTCCCCGTTTCTT
GACATGACTATGGGATCCTCCCTATAGTGAGACTACGGAATGCTAGGGGATACTCCTTGT
AGATCGTTTCATGATAAATGACGGTTACCTATGGGATCCTCCCTATAATGAGAGTTTGTT
TGCAGAGATTTTACCAATCGTTCGTCTCTTTTGAAAAGAAGATAGCTTCAACTCTTTTAT
ATGGCTAAGCGAGATTTTTGATTGTCTAATTCCAACTCTAAATGGTGGCTTTGGGCGAGA
CTCTTTACATGGCTAGTTGAGGTCTGAAATTAGAAGCTTAACGAGCCATCCTTCAAATTG
ACATGGGGGATAANATGAAAAACTTCACGATCGATGCCTTAGATTTCCCCATTCCCA
GenBank Accession BX287346 [GenBank]
Graphic View Graphic view of gene At4g36480
Predicted Position of Insertion Chr4:17220798 - go to primer design
BLAST e Value 1e-74
Hit Clone Code (BAC ID) AP22
Hit Gene Code At4g36480 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation long-chain base1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX287347 [GenBank]


Last Updated on 31.08.2016 09:40