SimpleSearch - Line and FST details


Line specific information

 
Line ID 400B05
Vector Used pAC161
Line Availability only available from NASC (N438321)
Segregation Analysis 100:100:74
Confirmed for Hit At1g18750
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g18750

 
Sequence (A. th genome BLAST matches underlined)
>34-K017894-022-400-B05-8409
ATGAAGCATTTACAGTTTAGAAGTCACAGATAAGGGGTATTTACAATTGAATATTTAGTT
TGGGAGCTTTTGGCTTTGGGAGAGATTAGAGACTCTAAAACAGAGCCTATGGGATCCTCC
CTATAGTGAGAAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGAAAA
TGTCCGCAGCGTTATTATAAAATGAAAGCACATTTTGATAAAACGACAAATTACGATCCG
TCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCAAC
GTGTCTACATTCACGTCCAAATGGGGGCTTAAATGAAAAACTTCACGATCGATGCCTTGA
TTTCGCCATTCCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNN
GenBank Accession BX004671 [GenBank]
Graphic View Graphic view of gene At1g18750
Predicted Position of Insertion Chr1:6467668 - go to primer design
BLAST e Value 1e-19
Hit Clone Code (BAC ID) F6A14
Hit Gene Code At1g18750 [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 65
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23