SimpleSearch - Line and FST details


Line specific information

 
Line ID 401E01
Vector Used pAC161
Line Availability only available from NASC (N438449)
Segregation Analysis 48:48:24
Confirmed for Hit At5g60740
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g60740

 
Sequence (A. th genome BLAST matches underlined)
>05-K018290-022-401-E01-8409
TGATCTGAAATTTCCCGGACATGAAGCCTTTACATTGAATATATCCTAGTATGGCCAGGT
TCGAAAAGTATGGCCAGGGTATAAGCTATACCAGTCACACAGTATACAAGACAGATGAGG
ACACATAATTGTCTGTAACTGTTGATCTTGGATTGTTGAAGAAGTAGAACATGGATAGAT
AAACAAGCGGCTTAACGATGGTGTTGAAGTGATCAACTGTGTCTTTCGCTATGGGATCCT
CCCCTATAGTGAGATCCNGCTCNNCTTTCTCTCCCNTANTGTAGTTTATCCACATAGAAA
GATCTTAATGCANTAATCTTACACAAGAGAGCTGAATAAAACGAAAAATTGTTGCCAGAA
TACATGAAAGAAGCAGAGTTGTTGTCAAAATAGCTTGAAAGTTTCTACTTACAAACAGCA
ATAACTGTATATGTATATCCCATGGCACCAAACGTTTCATCGCTCACTTTATCAAGCGTT
CCTAAGCAGATACCAGCAAGTAAAAGTATTAGGTAATCTACAGCTATGGGATCCTCCCTG
ATGGGGGANNNNNNNCNNNNNNNNGNGNNNNCCGGGNGCNGCCCGGCGACGGCGGGCGGC
CGCGCCGCGCCGGGGCCGCCCGCGCGGGCCNGCGGGCNCCCGCCCCNNCCCCCCCCCGCG
CAGCGGGGCCCGGCGCACGCCCCGGCCCCGCCGGGGGGGGACCGGGCAGCNCCCCCCACA
CCACGCGGCGGCATACGGCCGACGCGCCGACAAAGAGAGAGAAGAAAACA
GenBank Accession BX287434 [GenBank]
Graphic View Graphic view of gene At5g60740
Predicted Position of Insertion Chr5:24426338 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MUP24
Hit Gene Code At5g60740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ABC transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03