SimpleSearch - Line and FST details


Line specific information

 
Line ID 401F10
Vector Used pAC161
Line Availability only available from NASC (N438470)
Segregation Analysis 50:46:34
Confirmed for Hit At3g07800
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g07800

 
Sequence (A. th genome BLAST matches underlined)
>78-K018290-022-401-F10-8409
ATTTCCCGGACTTTTTCTTCATTGAATATTCCGGACATAGCAAGTCTCTGCCATGGCGAC
TCTCANAGCTTCCTTTTTGATCAAAACCCTCGACAGTGACGTCACCGGAGATTTTCTCTC
CGATCTGGAACGTCGTGGGTCAGGTGCTGTTCATGTTATCATGGGTCCTATGTTTTCTGG
GAAATCGACCTCTCTCCTTCGCCGAATCAAGTCAGAGATCAGCGACGGAAGGTACAGTTT
ATTTTCTATCTCCGTAGATTTTAATTGTTAGATCTATCTCCGTAAATTTCTTAATTTCGT
GTTTTGGTTAAGCAGAAGTGTTGCGATGCTGAAATCGAGTAAGGATACGAGATACGCANA
AGATTCGGTGGTGACACATGATGGAATTGGATTCCCTTGCTGGGCTCTTCCAGATCTCAT
GTCATTTCCTGAGAAATTCGGGCTATGGG
GenBank Accession BX287463 [GenBank]
Graphic View Graphic view of gene At3g07800
Predicted Position of Insertion Chr3:2490947 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MLP3
Hit Gene Code At3g07800 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Thymidine kinase
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23