SimpleSearch - Line and FST details


Line specific information

 
Line ID 401G11
Vector Used pAC161
Line Availability only available from NASC (N438483)
Segregation Analysis 50:50:39
Confirmed for Hit At2g20960
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At5g38430 can not be ordered because the confirmation of this insertion failed.

Gene hit At2g20960

 
Sequence (A. th genome BLAST matches underlined)
>87-K018291-022-401-G11-8409
TGATCATGTAAATTTCCCGGACATGAAGCCATTTAAATTGAATATATCCTGATCACCGAT
ATGCCACCTATGATAATAGGCCGAGGACACCCATACATGAGTCTGCTGCAACAGAAAGGA
GGCCCCAAACACCAGAAACTAGGCCGAGGACTCCTGAACACCGATCTGCCATCCCTGACA
CTATGGCAACGACACCAATGCGTGAGTCTGCTGCAACAGGAAGGAGGCCTCAAACACCAA
AAACTAGGCCGAGGACTGCACAACGTATAGGGAGGTCACCTGAGTTCATGGAAAGATCCC
CCGGACCAAGGTCCAAGACCCCAGAGCCTCAACCTACTTACTTCGAACCATCCTCAAGGA
CTCCNAAACAGCGGTCCAAGACGCCTGAACCCAGCCCTATGGGATCCTCCCTATNGTGAG
AGTNNCANAGATGCCTTGACGACGCTTCTCTTAAAATGCCTCGGACAGTTGAAACTACGC
CTA
GenBank Accession BX287480 [GenBank]
Graphic View Graphic view of gene At2g20960
Predicted Position of Insertion Chr2:9007940 - go to primer design
BLAST e Value 8e-178
Hit Clone Code (BAC ID) F5H14
Hit Gene Code At2g20960 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Arabidopsis phospholipase-like protein (PEARLI 4) family
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g38430

 
Sequence (A. th genome BLAST matches underlined)
>87-K018290-022-401-G11-8409
TGATCCTGAAATTTCCCGGACATGAAGCCTTTACATTGAATATATTCTCTTCAGCTGTGA
CTACAGTCAGCCGTGCTTCTACGGTGCAATCGGCCGCGGTGGCTCCATTCGGCGGCCTCA
AATCCATGACTGGATTCCCAGTTAAGAAGGTCAACACTGACATTACTTCCATTACAAGCA
ATGGTGGAAGAGTAAAGTGCATGGTGACGGTGTTCGGCATTCTGAATCTCACCGAGGACT
CCTTCTTCGATGAGAGCCGGCGGCTATGGGATCCTCCCTTATAGTGAG
GenBank Accession FR809626 [GenBank]
Graphic View Graphic view of gene At5g38430
Predicted Position of Insertion Chr5:15385032 - go to primer design
BLAST e Value 6e-06
Hit Clone Code (BAC ID) MXI10
Hit Gene Code At5g38430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribulose bisphosphate carboxylase (small chain) family protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on 07.07.2016 14:03