SimpleSearch - Line and FST details


Line specific information

 
Line ID 402B01
Vector Used pAC161
Line Availability only available from NASC (N438509)
Segregation Analysis 100:88:78
Confirmed for Hit At1g68650
Parent of DUPLO pair 2399
Parent of pair(s) 73618, 73629, 73641, 73650, 73657, 73664, 73672, 73679, 73683, 73689, 73690, 73691, 73692, 73693

Gene hit At1g68650

 
Sequence (A. th genome BLAST matches underlined)
>02-K017817-022-402-B01-8409
TGATCTGTAATTTCCCGGAATGAAGCCATTTACATTGAATATATACCTGAACATACGGAC
ATGAGGAGTACAGGCGCCGCTACCGTTCGCGGTAGAGAACATTGCGCTCGGTTGCAATGA
ACTCCATAACTGCCGCACAGGTGTTTATTCCCGAGAAGATTACTAGAGGGGACATTGAGC
CGAATAAGCTAAAAAGATCTTGCTGATTATTTCTGCAAAATAGAGGGACACTCATATTAA
TTAACATGTGATCAGTGAGAAATGTCGGCAGCATCGACGAAGACTTACGACCATAAAATA
TCATACTAAGGATGTGTAGATTTAGAAAGCAAAACATTCTGGGAAACCTCCTATGGGATC
CTCGTTATAGCGAGAGAACGTTTCTTTGTTAATTTTGGAGCCAATGTTCCTATGGGATCC
TCGCTATAGTGAG
GenBank Accession BX287504 [GenBank]
Graphic View Graphic view of gene At1g68650
Predicted Position of Insertion Chr1:25775814 - go to primer design
BLAST e Value 2e-09
Hit Clone Code (BAC ID) F24J5
Hit Gene Code At1g68650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Uncharacterized protein family (UPF0016)
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g15215

 
Sequence (A. th genome BLAST matches underlined)
>02-K017817-022-402-B01-8409
TGATCTGTAATTTCCCGGAATGAAGCCATTTACATTGAATATATACCTGAACATACGGAC
ATGAGGAGTACAGGCGCCGCTACCGTTCGCGGTAGAGAACATTGCGCTCGGTTGCAATGA
ACTCCATAACTGCCGCACAGGTGTTTATTCCCGAGAAGATTACTAGAGGGGACATTGAGC
CGAATAAGCTAAAAAGATCTTGCTGATTATTTCTGCAAAATAGAGGGACACTCATATTAA
TTAACATGTGATCAGTGAGAAATGTCGGCAGCATCGACGAAGACTTACGACCATAAAATA
TCATACTAAGGATGTGTAGATTTAGAAAGCAAAACATTCTGGGAAACCTCCTATGGGATC
CTCGTTATAGCGAGAGAACGTTTCTTTGTTAATTTTGGAGCCAATGTTCCTATGGGATCC
TCGCTATAGTGAG
GenBank Accession BX287504 [GenBank]
Graphic View Graphic view of gene At4g15215
Predicted Position of Insertion Chr4:8678007 - go to primer design
BLAST e Value 6e-83
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g15215 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation pleiotropic drug resistance 13
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit BX287505 [GenBank]


Last Updated on 31.08.2016 09:40