SimpleSearch - Line and FST details


Line specific information

 
Line ID 402G03
Vector Used pAC161
Line Availability only available from NASC (N438571)
Segregation Analysis 50:47:43
Confirmed for Hit At2g21990
Parent of DUPLO pair none
Parent of pair(s) 2733, 97310

Gene hit At1g26170

 
Sequence (A. th genome BLAST matches underlined)
>23-K017863-022-402-G03-8409
TTCCCGGACTGAAGCATTTACATTGAATATATTCCTGGAGAGGTGAACTACTTAAACTTC
ATTTGGTTTCTACTGTCTCTCCGACATCCTCCTATACCAAAGGGACAAGCGGGAATTTGA
AAATTGAGGGAAGCTAAAACAATTTTCAAACACTCAATTTCTTGATCCCATCTGGAATTG
GATTCCATTCGATTAATCTCTCAATGGTGGTGGACCAAGATCAGCAATTGGCTGCTCGGT
TGCTTTATTCAGCAAGTCTTGACCCTAACCAGAACGTTCGTTCTTTCGCTTGAGACCTCT
CTCAATCAGGCTTCTCTTCAACCAGGTCCGTTGCTTAAATCGTTTGGGTTACTTTTCAGC
TAT
GenBank Accession BX287561 [GenBank]
Graphic View Graphic view of gene At1g26170
Predicted Position of Insertion Chr1:9054604 - go to primer design
BLAST e Value 1e-154
Hit Clone Code (BAC ID) F28B23
Hit Gene Code At1g26170 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARM repeat superfamily protein
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At2g21990

 
Sequence (A. th genome BLAST matches underlined)
>23-K017817-022-402-G03-8409
GGACAGCACCGAAGCGGGTCAAGCGGATCAAGAGTTACCGGAACCTTATTCGGATACCGT
AAAGGCCGTGTAAGCCTCTCGATTCAAGAAAGCCCTATGGGATCCTCCCTATAGTGAGAC
TGTGGGATCCTCCCTATAGTGAGGCTATGGGATCCTCCCTATAGTGGGCTACACTGAATT
GGTAGCTCCCATTGGGACGTGAATGGAAACACACTATGGAATCCTCCCTATAGTGAGACC
AAGCTGAAAATGAAATGGGTATTCTGGGAATGGAAATATCTATGTCTACGTGCCTACATA
TACCATCAAAGGGGGGGTTAGAAGAAAAATTTCAACAGGGAGGCCTAAATATTCCCGAGA
GAGACCACTTTGTTTATTGCTTGTGGCTCTAAATATAACGGAGCGTAATTTGTCGGTATA
TCCAAATGTGCCTTCTTTTGTATAATAACGCTGCGGACATCTACATTTTTGAGTTGAAAA
AAACTTGGTAATTACTCGTTCTTTTTCGCCAAATAAAAGGGAGA
GenBank Accession BX287560 [GenBank]
Graphic View Graphic view of gene At2g21990
Predicted Position of Insertion Chr2:9360085 - go to primer design
BLAST e Value 6e-46
Hit Clone Code (BAC ID) F7D8
Hit Gene Code At2g21990 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein of unknown function, DUF617
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23