SimpleSearch - Line and FST details


Line specific information

 
Line ID 402G05
Vector Used pAC161
Line Availability only available from NASC (N438573)
Segregation Analysis 50:48:27
Confirmed for Hit At5g58280
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g58280

 
Sequence (A. th genome BLAST matches underlined)
>39-K017817-022-402-G05-8409
GATCATGACATTTCCCGGACTGAAGCCATTTACATTGAATATATCACGCCTACCACTAGT
TGACATTGATCCAAACCATCTCATGAGGTTTGTTGCTACAATACTCGCACAAACTATTAT
TGGTGAACATCACTGATTTGTATGGGAAATACTGATCGAATGTATACTTCGTAGACACTC
TATTGAGCTTCATTCCACCCACGAGGACATCCAAAAGGGAGAATCACCATGGTCACTATG
GGATCCTCCCTATAGTGAGAGTGGAGCATTCAAAGCTGCATAGAAGTTCCAGATGAGCCT
AAAATCTCCACATCCTTACTTTGTGAAATCTATGGGTCGCTCCCATGTTTACAGTTGCTT
TTGGCTGATACGTTCGTTCACAACACTTGTGTGTGTTGCTTCTTCAAGGATTAAATGTTA
GGACCTTACTTGACCTACATGGCATTTGCTTGCAAATTTCAAGGGGCTTCCTTCAAGATT
CTGTGCAGACAATTTTCCTGAGGAAACTATGGAAATAGAACTATGGGATC
GenBank Accession BX287562 [GenBank]
Graphic View Graphic view of gene At5g58280
Predicted Position of Insertion Chr5:23567785 - go to primer design
BLAST e Value 9e-113
Hit Clone Code (BAC ID) MCK7
Hit Gene Code At5g58280 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AP2/B3-like transcriptional factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03