SimpleSearch - Line and FST details


Line specific information

 
Line ID 403B02
Vector Used pAC161
Line Availability only available from NASC (N438606)
Segregation Analysis 57:55:53
Confirmed for Hit At2g25880
Parent of DUPLO pair none
Parent of pair(s) 1696, 9623

Gene hit At2g25880

 
Sequence (A. th genome BLAST matches underlined)
>24-K035334-022-403-B02C-8409
CGTTTCTCTCTTGCTAGATAACATGGCCAAACTTTCCTCTACCAAGTGGCTTTCCGATAT
CGAAATCGCTTGTAGTCCATCTCTTTTGTGCAGCCTCTGAAGCCGCCTGATACAACATTA
TCACAAAGATTGAAATCCAATCAACTCTCAGATACACTTAATCATAAACGACAAACAATC
ATTGATACTTTAAAACTTGAAGATAAAAGGATAAAATCAACAGCTCCTTAACACTAATCC
ACGGATTTGTCAATTAATCTAGGGTCCTCGCTGTAAACGAATAAATCCACAATCATATCA
TGAAATTTCTCAAAATCATACCAACAAGTCTTTCTCAAATTAAACAGAGAACATTGAAAC
AAGATTCTTTCTGGCGCAAAGAAAATCAAGCAACCAAATCGATAATCCCAGATCACATTC
CATTAGAACAGACCAAACGCAGAGAAAAAACGCAAACCAACAAGGAAGTAAAA
GenBank Accession HG968959 [GenBank]
Graphic View Graphic view of gene At2g25880
Predicted Position of Insertion Chr2:11036246 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F17H15
Hit Gene Code At2g25880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ataurora2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX287605 [GenBank]

Gene hit At5g02020

 
Sequence (A. th genome BLAST matches underlined)
>10-K017864-022-403-B02-8409
TCCCATATAAACCAGACAAGGAACCTTTCGCAACCCAGCACCGATAATAACCAGACCGAT
TTGAACAGTTCTAGACATAACAAAGAGTTTCAAAGAGCTATGGGATCCTCCCTATAGTGA
GATCTTAGACACAATCCGGGCTATGGGATCCTCCCTCTGGTGAGACTTCCCAGTGTACGC
CTTGGGGTTCTCGGTGTACTTGGTATCCACAGGAAAGAGACCTTTTCGACCTTTTTCCCC
TGCTATGGGATCCTCCCTATAGTGAGANNNTCANCAAAACTTTCATTCGACTAGATTCAC
TTCTTATCCGGCGGCGGATTTAAATGAGAAAGTGATCGACCCTTTGGTGTAGTTCGGAAT
TCCAAATTNCAACGTGGCGTCCTTTCCGTCCAAATGGGGGCTTAGATGAGAAACTTCCCC
GATCCATGCCTTGATTTCCCCATTTCCA
GenBank Accession FR809644 [GenBank]
Graphic View Graphic view of gene At5g02020
Predicted Position of Insertion Chr5:386037 - go to primer design
BLAST e Value 8e-33
Hit Clone Code (BAC ID) T7H20
Hit Gene Code At5g02020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation E3 ubiquitin-protein ligase RLIM-like protein
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 31.08.2016 09:40