SimpleSearch - Line and FST details


Line specific information

 
Line ID 405E03
Vector Used pAC161
Line Availability only available from NASC (N438835)
Segregation Analysis 50:42:31
Confirmed for Hit At2g24740
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g24740

 
Sequence (A. th genome BLAST matches underlined)
>21-K017820-022-405-E03-8409
TTTAGTCCCCGAGAAAAATCTGATGCTGTTAATGAAGAAGCCCACGCAACATCAGTACCT
CCTCATGCACCGCCACAAACCCTTTGGCTATTAGATAACTTCAACATTGAGGACTCTTAT
GACCGAGATGCTGGTCCTATGGGAGCCTCCCTATACAGAGAAAGATCAGATGCTGTTAAT
GAAGAAGCCCACGCAACATCAATACCTCCTCATGCACCGCCACAAACCCTTTGGCTATTA
GATAACTTCAACATTGAGGACTCTTATGACCGAGATGCCGGTCCTATGACTACCTCACTA
TACCGAGAAGCATCTCATGAAGTCAATGAAGACGCCCACGCAACATCAGCACCTCCTCAT
GTAATGGTCTCACCACTACAAAACAGAAGACCATTTGATCAATTCAACAACCAACCTTAT
GATGCGAGTGCTGGTCCTATGGGATCCCCCTTATAGTGAGAACGTGGCCGACCAAAGGGT
TCGAAAAATGGGTCGAGAAAGCCAAAAAAGCCAAAAGCATATGACAACAACTCTACTGAT
GCGAGTGCTGGTCCTATGGGAACCTCCCTATAGGGAGGAGNAACCNGAGGGAGGCTCCCC
GTAAGGTAGTGAAAGGAATGTAAAGGGACGAACAGTGTGGGTGCGCGGCCGCACGCGGGG
GCGGGGAAGAAAAAAAAAAAAAGGGCGGAGCACGGGGGGGGAGAAGATAAATAAGAAGGG
CCGGGGGTCCCGAGCCGGGGGGGACTGGGGAGGGGGACCCCACAAAAGAAAAGTGCGGGG
GGGGGCGGGGATGCCCCCACCAAAACAACAAGNGCGGGGGTGGGGGGGGGGGGCCGCNAA
AAAAACGGGGGCGGAAAACCGGGGGGGGGGTGGACAAGCCGCTTTAAGGGCGGCTCTT
GenBank Accession BX287863 [GenBank]
Graphic View Graphic view of gene At2g24740
Predicted Position of Insertion Chr2:10531892 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F27A10
Hit Gene Code At2g24740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SET domain group 21
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40