SimpleSearch - Line and FST details


Line specific information

 
Line ID 406G11
Vector Used pAC161
Line Availability only available from NASC (N438963)
Segregation Analysis 50:18:15
Confirmed for Hit At1g17460
Parent of DUPLO pair none
Parent of pair(s) 2517

Gene hit At1g17460

 
Sequence (A. th genome BLAST matches underlined)
>87-K017952-022-406-G11-8409
TGATCTGTAGATTTCCGGACATGAAGCCATTTACAATTGAATATATCCTGACAATTGTAC
ATATTGATTCATGTGTAGTTCCAACAACTACCCTGACAATTAATGATAGCAAACTGATTG
GTGGAGATCAAGATGCAATTGATGCTTTTAGCAAGGGTACAGTAGATGAAGAAACAGCTA
CTGAAAGCATAGATACACCAGCTATGGGATCTCCCCTATAGTGAGACTATNNNATCCTCC
CTATANTGGNCTACACTTAATTGGNAACTCCCTTTTGTCCTCTAATTAAAACACAATACC
TTCTCTTTAAAACTCAAAATAACTACACCCCCTTATTCTTATTTCCGAAAACATTAAAAA
AAATAATTTCTATTCTCCAACTCCTTAATTTG
GenBank Accession BX287971 [GenBank]
Graphic View Graphic view of gene At1g17460
Predicted Position of Insertion Chr1:6000837 - go to primer design
BLAST e Value 4e-72
Hit Clone Code (BAC ID) F1L3
Hit Gene Code At1g17460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TRF-like 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX287972 [GenBank]


Last Updated on 31.08.2016 09:40