SimpleSearch - Line and FST details


Line specific information

 
Line ID 407D08
Vector Used pAC161
Line Availability only available from NASC (N439020)
Segregation Analysis 50:49:40
Confirmed for Hit At1g54870
Parent of DUPLO pair 2335
Parent of pair(s) none

Gene hit At1g54870

 
Sequence (A. th genome BLAST matches underlined)
>60-K017953-022-407-D08-8409
TGATCTGANATTTCCCGGACTGAAGCCATTTACATTGAATATATCCTGATTTACATCCAT
GTTGTTAAAGAAATATTAAAATCACCTTACCCTGATTTACATCCATGTTGTTAAAGAAAT
ATTAAAATCTCAAATCCTTTAAAATAATTAGCTAATTGAGTGAATTTGAATTGAGATCAA
ATTATCTTATGAAATATATACCAATATGCATATACAAATTTACGTACTCGAAAAATGAAT
ATGGTACGTAAAGATTTGAAATTATGTAATATTTTGATCTCAAACTAAAGGTTATAAAAA
ATTACACGAAGCTTGTTGGAAGGTTGGTAATCTGAGCTATGGGATCCCCCCTAATAGTGA
G
GenBank Accession BX288015 [GenBank]
Graphic View Graphic view of gene At1g54870
Predicted Position of Insertion Chr1:20459506 - go to primer design
BLAST e Value 3e-143
Hit Clone Code (BAC ID) F14C21
Hit Gene Code At1g54870 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD(P)-binding Rossmann-fold superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX288015 [GenBank]


Last Updated on 31.08.2016 09:40