SimpleSearch - Line and FST details


Line specific information

 
Line ID 411B06
Vector Used pAC161
Line Availability only available from NASC (N439378)
Segregation Analysis 60:58:47
Confirmed for Hit At4g39250
Parent of DUPLO pair none
Parent of pair(s) 66348, 96098

Gene hit At4g39250

 
Sequence (A. th genome BLAST matches underlined)
>42-K017996-022-411-B06-8409
ATGAAGCATTTACATGACCGTTCTCTATGCTGTTGATGTCTTGCACTAAGAGTTCGTAGT
GTCTCTTTACCTCCTCTGTATGTTTTTCCACCCACGACTTTGGCAACATTTTGCCAACGG
TTAGGAGTGTCCTGGTCATAGGTTGCTATGGGATCTCCCCTATAGTGAGAAAAGNANNTN
NNGNTNNNNCNNCTTTTTTTAGCCGCCAAATTGATAGGCGAACCCAGTAAACAATTAATT
GAAATTCGGTATTGTTAATTCCAACGTGTCTACTTTCCCGTCTTAATGGGGGATTAGATA
AAAAACTTATCGAACTATGCATTGATTTCTCCAGACCAGCCTACATTCACGTCCGAAGGG
GGGATGAGATAAAAAACTTCCGAATCAATGCCTTGATT
GenBank Accession BX288255 [GenBank]
Graphic View Graphic view of gene At4g39250
Predicted Position of Insertion Chr4:18271646 - go to primer design
BLAST e Value 8e-67
Hit Clone Code (BAC ID) T22F8
Hit Gene Code At4g39250 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RAD-like 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23