SimpleSearch - Line and FST details


Line specific information

 
Line ID 413B10
Vector Used pAC161
Line Availability only available from NASC (N439574)
Segregation Analysis 50:30:24
Confirmed for Hit At3g53810
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g53810

 
Sequence (A. th genome BLAST matches underlined)
>74-K025921-022-413-B10-8409
AGCCACTTACAATTGAATATATCCTGGATCATTGGAGAACGATGATACGTTGCCGTTTTT
GGGAATCTTTGAACCGGATTCGTTCAGTATGGGATCCTCCCTATAGTGAGAGCNANNAAA
CNAGGATCGGTGACCCTCCCATTGGAGACTCCGTAGACACCCTCCTTAGATCCAAGATAC
GTAGAGCGGACGTCTAGGAGGGGGGGGGGGGGGANCCTATTTNANCCACCACACAAANGN
GTGTTTATTTTTAATGAGGGGTTAGTATACTGAAAGGGACGATGTGGTTCGCTTTTTGCA
TCGAACCACGAGGGTAAACTGGAGACGCTTTGTGGCAGCTTACGCCGGATGAACTCTTAG
ACGTTCATGTTGCATGTCCAATTTGGGAAACGAGAATGCTGGATTATCTTATACCTTTCG
TATATCCTT
GenBank Accession CR397022 [GenBank]
Graphic View Graphic view of gene At3g53810
Predicted Position of Insertion Chr3:19934928 - go to primer design
BLAST e Value 7e-17
Hit Clone Code (BAC ID) F5K20
Hit Gene Code At3g53810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Concanavalin A-like lectin protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR397022 [GenBank]


Last Updated on 31.08.2016 09:40