SimpleSearch - Line and FST details


Line specific information

 
Line ID 413C02
Vector Used pAC161
Line Availability only available from NASC (N439578)
Segregation Analysis 50:50:44
Confirmed for Hit At4g16070 At1g66370
Parent of DUPLO pair 11940
Parent of pair(s) 9713, 10815

Gene hit F6D8

 
Sequence (A. th genome BLAST matches underlined)
>11-K025921-022-413-C02-8409
CGGACAGAAGCATTTACAATTGAGTATATCCTGAGTGGATCCGTTATTCATATAGGCAGT
GAGCCTAGCACGACTTGCGCCCAAAGGGACCCGCCCTAACTAAAGGCTGTTATATAACTT
ATCAACAGGACTTTTTTATACCACCCTAATTTTTTTCTCTGACCCCGCGGGGTAATTTAA
CTGTCTATCTCAATTACGATTTTATGCTATGTTGAGTTTATATTTCTTCTGATTATATCA
AATACATTTCCATATCTATAGATCTTCTTCATACACTGTAAAAAAAATCTAGTATTTCAA
CTTTTGTATGTATTAAAAATTGCAAGATTTTGTAATCATGGGATCCTCCCTATCGTGATT
CTAGTATAACACTGTAGTCTGACAAGAAATTTGCTTTACTTGAAATAATATTTCCTCTGT
AGGTGGGGGGGGGGGAGAAAAAGATTTTTCCTCAATCATCATCATCATCCCCAC
GenBank Accession CR397028 [GenBank]
Graphic View Graphic view of sequence CR397028 of line 413C02
Predicted Position of Insertion Chr1:19572656 - go to primer design
BLAST e Value 8e-38
Hit Clone Code (BAC ID) F6D8
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At4g16070

 
Sequence (A. th genome BLAST matches underlined)
>11-K017998-022-413-C02-8409
GAAGTGCTTGCCTGATGCTGCTATATCCCAAGCATACAAGCAGCTGCCAGCTGCTCAATT
TGAAATTCACTGCATATTAACAATTTTTGACCCCGAGAACTAATTGACATATAAAAAGCT
GAGCATCACAATTAAAGGACACGACGCATATCATATCTGAAGACTAGAAAATACCCCCAT
TAATCCTTAAATTGGGTGAACCTGGTGCAAAAGTGAAACA
GenBank Accession BX288388 [GenBank]
Graphic View Graphic view of gene At4g16070
Predicted Position of Insertion Chr4:9098464 - go to primer design
BLAST e Value 2e-58
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g16070 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Mono-/di-acylglycerol lipase, N-terminal;Lipase, class 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g66370

 
Sequence (A. th genome BLAST matches underlined)
>11-K025920-022-413-C02-8409
TTAGCAGGCCGACCAAGCAATCTACCAGCGATCAAGGACCACCTAAACATTGTGAAACAA
TATACATGAGAGTTTCTAGTATTGAACCGCGATCCCTAAAGAAATAGTATTGACTATCGA
GAAAACAATACCTATTTCCTAGAAGTTTATGAAGGCGAAGAACAAGATCAACTTCATCGG
AGCAGAGTTTTCCTCTCTTAATACTTGGCTTCAAATAATTCAACCATCTAAGTCTACAAC
TCTTTCGGCACCGATTGAGACCTATAAAACCAAAAGTCGAATTTACTATACCTACTTAGA
TTTCTTTTGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR397027 [GenBank]
Graphic View Graphic view of gene At1g66370
Predicted Position of Insertion Chr1:24754222 - go to primer design
BLAST e Value 7e-171
Hit Clone Code (BAC ID) T27F4
Hit Gene Code At1g66370 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 113
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03