SimpleSearch - Line and FST details


Line specific information

 
Line ID 414B10
Vector Used pAC161
Line Availability only available from NASC (N439670)
Segregation Analysis 50:49:39
Confirmed for Hit At1g72850 At2g33710
Parent of DUPLO pair 2533
Parent of pair(s) none
Note Although the line exists, the insertion in At3g53810 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g72850

 
Sequence (A. th genome BLAST matches underlined)
>74-K026070-022-414-B10-8409
GAAATCGAGGTTTTGTTGAAACCGACAAAAAACCTGTGTTTGAAATTGTTCATCAATCGG
TTAGCAAGCTCTTTCCGTATGGGATCCTCCCTATAGGGAGAAGGATGANNAGNGNTGGGA
GAAGGAACTGCNTCAACTGGAGGGAGANCAAGAAAAAGCTATTATGGAAATCACGAGCAA
GAGATACACAAGAGCAGGAAAAAGGGAAGAAGATAACGAGAATTTCCCATCATTTATTCT
CTTGAGNGATGATTAATAAGTGAATGAATCCCTCAAGAAGATATTAATAAAGTGATGATC
TGTTA
GenBank Accession CR397115 [GenBank]
Graphic View Graphic view of gene At1g72850
Predicted Position of Insertion Chr1:27414894 - go to primer design
BLAST e Value 5e-76
Hit Clone Code (BAC ID) F3N23
Hit Gene Code At1g72850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Disease resistance protein (TIR-NBS class)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g53810

 
Sequence (A. th genome BLAST matches underlined)
>74-K018037-022-414-B10-8409
TTGATATATCCCAACACTAAGCGGCCATGGAATCGCCTTCGTTGTAGCTCCAACGCTATG
GGATCCTCCCTATAGTGAGAGTTAAAATGAAACTACATTACGGGATTTTCCCTATAGCGA
GACGGACATCTACCTTTTTGAATTGAAAAAAAATAGGAAATTACTCTTTCTTTTTCTCCA
AATAGACCATCATACTCATTGCTGATCCATGAAAATATTTCTGCCATGAAGGAATTTTCA
ATTGCAAATATCCT
GenBank Accession BX288422 [GenBank]
Graphic View Graphic view of gene At3g53810
Predicted Position of Insertion Chr3:19934898 - go to primer design
BLAST e Value 3e-20
Hit Clone Code (BAC ID) F5K20
Hit Gene Code At3g53810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Concanavalin A-like lectin protein kinase family protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 413B10

Gene hit At2g33710

 
Sequence (A. th genome BLAST matches underlined)
>74-K018043-022-414-B10-8409
TATCCTGTTATTTCCCGGACATGAAGCCTTTACATTGAATTGCAAATGATAATATCTGTC
TTATTATCCAATGCTCATATATTTTTCAACGCGTTGAATGATGAAATGGTTGGTAAATAA
AAATGAAACTAAACTATGGGATCCTCCCTATAGTGAGACTGAGATCTACGCTTTTGAATT
GAATACACTTTGATACTAACACTTTCTTTTTCTCTTTACTGACTCTGATACTGATTGCTG
ATCCATGTAGATTTCCCGGACTCCCTGCCATTTACAATTGAATTGCAAATGATAATATCT
GTCTTATTATCCAATGCTCATATATTTTTCAACGCGTTGAATGATGAAATGGGTGGTAAA
TAAAAATGAAACTAAACTATGGGATCCTCCCTATAGTGAGGACCCGCGATAGTCGGGTAA
GTGGACAACACGATTACCCCGCGGGGTTTTCAAGCAAGCCCCCACGACAGCTTCCAACTA
CACCCTTCCTTCCTTTTTAGAACCCTCCATCTAAACAACAACTCACACCC
GenBank Accession BX288423 [GenBank]
Graphic View Graphic view of gene At2g33710
Predicted Position of Insertion Chr2:14258723 - go to primer design
BLAST e Value 1e-40
Hit Clone Code (BAC ID) T1B8
Hit Gene Code At2g33710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Integrase-type DNA-binding superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40