SimpleSearch - Line and FST details


Line specific information

 
Line ID 414B11
Vector Used pAC161
Line Availability only available from NASC (N439671)
Segregation Analysis 50:38:26
Confirmed for Hit F9E21
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At2g46400 can not be ordered because the confirmation of this insertion failed.

Gene hit At2g46400

 
Sequence (A. th genome BLAST matches underlined)
>82-K026070-022-414-B11-8409
ACATTAAGCATTTACATTGAAGATATCCTGTACAGACATACTCACTGTGAATCCATCCCT
ATAGCGAGACTTAAGAGACTCAGTTTGCCATCGGCGCTATTATGAGATCCTCCAGTTATT
TTTAGGTATGCTCTCCCCCCATTCTCTAGCCGTATTATAATGGCATTCCCTATCGAGTAT
AAAGTTATCCTCACAATGGCGTTCCGCATACTACCGAGGATAGCAAAAATCACGGTTTTT
TTGGAATCCACTAAAAAAGTGTGTTTGACATTGTTCATCAATCGGTTAGCAAGCTCTTTC
CGTATGGGATCCTCCCTATAGTGAGANGTNTNANNCN
GenBank Accession CR397116 [GenBank]
Graphic View Graphic view of gene At2g46400
Predicted Position of Insertion Chr2:19044440 - go to primer design
BLAST e Value 2e-14
Hit Clone Code (BAC ID) F11C10
Hit Gene Code At2g46400 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 46
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 038C07

Gene hit F9E21

 
Sequence (A. th genome BLAST matches underlined)
>82-K018043-022-414-B11-8409
TGATCTGANATTTCCCGGACTGAAGCCATTTACATTGAATATATCCTGCCACACCTATGT
ACGGTAAGAATGCACATTTAGGTGGATAGTTTCTCGGCTTTTCCGGTTATTATTAGCTAT
AGATATAGGGAGTTTCGCGGCACGCCCACCGATTATTCCATAATTAGAGTTTGAGTTTAA
GAATGGTTCGATAAAAACCTATGGGATCCTCNCTATAGTGACGACAGATAACCTATGGGA
TCCTCCCTATATTGAGAGGACATGAAGCCATTTACCCTCGAATATATCCTGCCACACCTA
TGCACGGTGAGAATGCACCTTTAGGCGATTCGTTTCTCTGCTTGTCCGAGGAATATTACC
TATAGATCTATGGAGATTCGCGGAACGCCCACCGATTATTCCATAGTCAGAGTGGGAGTT
TAGAATAGGATCTTAAAGAGCTATGGGATCCTCCCTAAAGAGAGANNGNNNNCCCTATGG
ACACCTTCGGGGNGGCCCGCGGCCAGCGNCCTCGTCCGCGCGACCCGCAAAACNCGGACA
AACGCCAAAATTCCACACCTTACAC
GenBank Accession BX288425 [GenBank]
Graphic View Graphic view of sequence BX288425 of line 414B11
Predicted Position of Insertion Chr4:3149709 - go to primer design
BLAST e Value 2e-73
Hit Clone Code (BAC ID) F9E21
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX288424 [GenBank]


Last Updated on 31.08.2016 09:40