SimpleSearch - Line and FST details


Line specific information

 
Line ID 414D07
Vector Used pAC161
Line Availability only available from NASC (N439691)
Segregation Analysis 50:47:45
Confirmed for Hit At3g27925
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g27925

 
Sequence (A. th genome BLAST matches underlined)
>52-K026070-022-414-D07-8409
ATGATGATACTCTACATTTTAGGCCGTTGGCCGGGGTTAAAGCTTTATTCCTCCTGCGTA
TGGAATCCCCTCCATAGTGAGTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCC
AGTTAATAGTTTGCGCGACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTC
GTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCC
CATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAANTAAGTT
GGCCGCAGTGTTATCACTCATGGTTATGGCAACACTGGATAGTTCTCTTA
GenBank Accession FR809855 [GenBank]
Graphic View Graphic view of gene At3g27925
Predicted Position of Insertion Chr3:10368829 - go to primer design
BLAST e Value 0.21
Hit Clone Code (BAC ID) K24A2
Hit Gene Code At3g27925 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DegP protease 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR809855 [GenBank]


Last Updated on 31.08.2016 09:40