SimpleSearch - Line and FST details


Line specific information

 
Line ID 414D07
Vector Used pAC161
Line Availability only available from NASC (N439691)
Segregation Analysis 50:47:45
Confirmed for Hit At3g27925
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g27925

 
Sequence (A. th genome BLAST matches underlined)
>52-K026073-022-414-D07-8409
AATTTCTCGGTACCCTATCTGATCCTAATGCTATTTCCGAATCCTCTCGAAACATTTGTA
TGCGACGACAACTTAGACGACGATGATGATACTCTTCATTTTACTCCGTTCTCCGCCGTT
AAACCTTTCTTCCTCCTCTGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR397139 [GenBank]
Graphic View Graphic view of gene At3g27925
Predicted Position of Insertion Chr3:10368819 - go to primer design
BLAST e Value 8e-35
Hit Clone Code (BAC ID) K24A2
Hit Gene Code At3g27925 [TAIR] [MIPS] [SIGnAL]
Gene Annotation DegP protease 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23