SimpleSearch - Line and FST details


Line specific information

 
Line ID 414F05
Vector Used pAC161
Line Availability only available from NASC (N439713)
Segregation Analysis 50:50:45
Confirmed for Hit At5g67250
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g67250

 
Sequence (A. th genome BLAST matches underlined)
>38-K018037-022-414-F05-8409
AATGAAATACACACCTCATGCGATCTCGTCCCATTAGCCGAGCACCGTGAACTACGGCCT
ACTCTAACGGACGAGAGTTACATCTCGACGTTATGGTCTCCGGTGATTGTTGCTGGAGGT
GAATCGATGGCTATGGGATCCTCCCTATATCGAGATTTCACCTGAGATCTGCCCGATGAC
TGTTTACCTCATGTGTCTCCGTATCTTGGAGCTGGAGATCGGAAGCCATGCTCTCTTGTT
TGTAAACGGTGGTTGCTCGTCTACTGTCAGAGTCATCATCGGGTATCTCTATGGGATCCT
CCCTATAGTGAGAGAC
GenBank Accession BX288449 [GenBank]
Graphic View Graphic view of gene At5g67250
Predicted Position of Insertion Chr5:26833273 - go to primer design
BLAST e Value 2e-55
Hit Clone Code (BAC ID) K21H1
Hit Gene Code At5g67250 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SKP1/ASK1-interacting protein 2
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g48090

 
Sequence (A. th genome BLAST matches underlined)
>38-K026073-022-414-F05-8409
ACCACCCTATATGGAGCCAGTGATTAAATTTGGAATCTAATTAGGGACATGGACATGAAC
GTGAGAAAGAAAGATTATTCAATAAATTAAATTTAGCTTTTGTGTTTTGAAAAAATCATA
AGAAAAAAAGAAGAGAATTAAAGCACTAAGGTTAATCTCATAATATTTCCAAAAGCTAAA
GATGTGGTAATGTTTCTTCTCTCGCACTCCAACAAGTTAAGTCATATATTCAGGTAGGGG
ATATCTCCATGTCTTGTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR397167 [GenBank]
Graphic View Graphic view of gene At5g48090
Predicted Position of Insertion Chr5:19488613 - go to primer design
BLAST e Value 9e-121
Hit Clone Code (BAC ID) MDN11
Hit Gene Code At5g48090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation EDM2-like protein1
Insertion Classification TS2TE (3')
Confirmation Status unknown


Last Updated on 07.07.2016 14:03