SimpleSearch - Line and FST details


Line specific information

 
Line ID 416E03
Vector Used pAC161
Line Availability only available from NASC (N439891)
Segregation Analysis 50:49:49
Confirmed for Hit At1g70170
Parent of DUPLO pair none
Parent of pair(s) 7040, 11126

Gene hit At1g70170

 
Sequence (A. th genome BLAST matches underlined)
>21-K018045-022-416-E03-8409
TGATCATGTAGATTTCCCGGACATGAAGCCATTTACAAGAGAGCACGTCCCTACTTTTCG
ATTCTCAATTTGATTTAGATGCCTAAATATTGTCGCTTTACAAAAAAATTCGACTTTTTT
CCATTTTTCTCACGATAGATTATTATTATTAAAACACAAAGAACAAAGGATACTCCACCA
AATAATTTTCCTTTTCCTGGTAGGAATCCGAGTTGTGTAATGTGTAACTATGGGATCCTC
TCTATAGCGAGAGCATCCTCTCCACGATATAGAGGGGTTAGATACGGAGGTCGAGAAACC
GCCCTGACTTGACCTACACGTTCGACCCGAAAAACCCGTTGACGGAAGAGGTCAAGAGCG
TGTTCTCACGCGCTTTTGGTCGTTGGTCTGACGTCACCGCGTTAAACTTCACTCTTTCCG
AGTCTTTCTCGACGTCTGACATCACAATCGGATTCTACACCGGCGACCATGGTGACGGAG
AGCCTTTCGACGGCGTTTTGGGAACATTAGCTCACGCTTTCTCTCCTCCCAGCGGGAAAT
TCCACCTATGGGATCCTCCTTATAGTGAGANNNANNNNANNNNNNNTTNCCNNTTNNTTT
TTCCNTTTCAAAATGTAAATGCCCCCCCCGGTTATTATAAAATGAAAAGTACATTTTTAA
TAAAACCAACAAATTACGATCCGTCGTATTTATAGGGCGAAAGCCATAAAAACAATTATT
TCTAGTTCGGAAAATCTTAATTTCGAAGTGGCTCACATTCCACGTCCCAATGGGGGGCTT
AAAAGAAAAAACTTCCCGAGCGATGCC
GenBank Accession BX288521 [GenBank]
Graphic View Graphic view of gene At1g70170
Predicted Position of Insertion Chr1:26424265 - go to primer design
BLAST e Value 2e-138
Hit Clone Code (BAC ID) F20P5
Hit Gene Code At1g70170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation matrix metalloproteinase
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03