SimpleSearch - Line and FST details


Line specific information

 
Line ID 418B07
Vector Used pAC161
Line Availability only available from NASC (N440051)
Segregation Analysis 50:50:48
Confirmed for Hit At1g65820
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g65820

 
Sequence (A. th genome BLAST matches underlined)
>50-K018099-022-418-B07-8409
TGATCTGANATTTCCCGGACATGAAGCCTTTACATTGAATATATCCTACAATTTGAAAAT
TACTAATAAATTGAATAACATTCTCTGAAATATCAAAGAGCTTAAACTCATATTGGGCCT
ACGACTAAATGATTTAGGCCCATACGACTTATCATTTCCACATTGGGCCCAATCCATTCT
TTCCCGATAAATTCCGATGCAACTCCGATGATCGATCCGATGCGTCTTTGGCTATGGGAT
CCTCCCTATAGTGAGATCCATAATCCGGCAGCCCAGCGTCGCTGATGGGAGATTGATGCT
ATGGGAGCCTCGCTATAGTGAGAATACNANCCGCCGATAAAACCAAGAAGGAGTCTCTCT
ATTAGCTGACTTACCAATACACTCTGCACATTGCCAGGCTATGGGATCCTCCCTATAGAG
AGAATAGTACCCCAACGGGAGATGCTTAGAACGCTCTGGGATCCTCCCCATAGCGAGACT
GTGACCTGAAAGAACCGAACGTAGTGAAACGGGAAAGGCGGCGGGGAGCGAAGGCGGAGG
AAGAAGAAAAGGAAGGGGAGAAGGGGAGGAAGGAGCCGGCATGCAAGAGGACAGGGGGCG
GGCAAGAGGGGCGGGGAGGAGAGGGAGACAGGAGACGAGGAAGAAGGGAAAGACGGAGGA
GGGATAGAAGAGCGACAGAAGGTAGGGGGGAGGAAAAGCCGACGGCACGACAACAGATGG
AGGCACAGAACGCCAGACAGCCCAGACACCGACACAAAGAGGGATGAACGCGATGACCCA
ATAAACAATCAAAAGAAGGGTATCAAGGCGCGAAAAAAGAAGAAGTAAGAGTAT
GenBank Accession BX288608 [GenBank]
Graphic View Graphic view of gene At1g65820
Predicted Position of Insertion Chr1:24485038 - go to primer design
BLAST e Value 3e-97
Hit Clone Code (BAC ID) F1E22
Hit Gene Code At1g65820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation microsomal glutathione s-transferase, putative
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX288609 [GenBank]


Last Updated on 07.07.2016 14:03