SimpleSearch - Line and FST details


Line specific information

 
Line ID 421B06
Vector Used pAC161
Line Availability only available from NASC (N440338)
Segregation Analysis 103:101:80
Confirmed for Hit At5g44790
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g44790

 
Sequence (A. th genome BLAST matches underlined)
>42-K018102-022-421-B06-8409
ATTTCCCGGACTGAAGCCTTTCTTTTTCTTCGAGTATTTTATATAGGAGCTGAAGTAAAA
AAAGAAAAGCATTTTATAGGAGAAATCTATTATTACTATGTACGTATGTAATTAAAGGAA
ATATTAATAGTACTTGTTCAAGAGTTAACAAAAAATCTGGAAATATTAATAGAGTTTTAA
AATATCTGAAAACATTTAAAAAAAAAACTGAGAATCTTATTAGATTTTTAATGAAGAATC
TATGGGATCCTCCCTGATCGTGAGAGGGGAAAAA
GenBank Accession BX288889 [GenBank]
Graphic View Graphic view of gene At5g44790
Predicted Position of Insertion Chr5:18080225 - go to primer design
BLAST e Value 6e-77
Hit Clone Code (BAC ID) K23L20
Hit Gene Code At5g44790 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation copper-exporting ATPase / responsive-to-antagonist 1 / copper-transporting ATPase (RAN1)
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX288889 [GenBank]


Last Updated on 31.08.2016 09:40