SimpleSearch - Line and FST details


Line specific information

 
Line ID 421G12
Vector Used pAC161
Line Availability only available from NASC (N440404)
Segregation Analysis 50:50:41
Confirmed for Hit At5g13220
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g13220

 
Sequence (A. th genome BLAST matches underlined)
>95-K018102-022-421-G12-8409
TTTCCCGGACATGAGCCTTTACTCTAAAGGGATTTTTACCCCCGAATAATTAAAGAAAGG
TTTTTATTGTTCTCTCTCTCGACCTTTTTTTTATCTATAAGTTATTTAAGATAGCAATTA
TGGGTCCTGCCTCTTTTACTCTCACATACAACTTAAGATTCAGCTATGGGATCCTCCCTA
TAGTGAGAGAGAGGGNNCCCCCTTTTTCCCNGTTTTTTTTCAATTCATAAAGGTAGAGGT
CCGCCCC
GenBank Accession BX288941 [GenBank]
Graphic View Graphic view of gene At5g13220
Predicted Position of Insertion Chr5:4220016 - go to primer design
BLAST e Value 6e-43
Hit Clone Code (BAC ID) T31B5
Hit Gene Code At5g13220 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation jasmonate-zim-domain protein 10
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03