SimpleSearch - Line and FST details


Line specific information

 
Line ID 422C08
Vector Used pAC161
Line Availability only available from NASC (N440448)
Segregation Analysis 50:50:39
Confirmed for Hit At5g16560
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g16560

 
Sequence (A. th genome BLAST matches underlined)
>59-K017808-022-422-C08-8409
TTTCCCGGACTGAAGCATTTACATTGAATATATCATGGCATCCATGTCTCTCTATTTTAT
GATTTAAGAAAAGAAAGAAAACAAATTAAGGACAAATTGTATTTATTGATGTATAGATGC
CCTAAAAATAAAATAAAAATCACTACACACAAATTGCGTTTTTTTGCAACTTGCTATATG
ACCACAATCTACATGTCATACTTATGAAGCAAAATTCGTTTATCCTATGGGATCTCCCNT
TATAGTGAG
GenBank Accession BX288987 [GenBank]
Graphic View Graphic view of gene At5g16560
Predicted Position of Insertion Chr5:5407665 - go to primer design
BLAST e Value 1e-59
Hit Clone Code (BAC ID) MQK4
Hit Gene Code At5g16560 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Homeodomain-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23