SimpleSearch - Line and FST details


Line specific information

 
Line ID 423F02
Vector Used pAC161
Line Availability only available from NASC (N440574)
Segregation Analysis 50:50:44
Confirmed for Hit At3g03120
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g03120

 
Sequence (A. th genome BLAST matches underlined)
>14-K017847-022-423-F02-8409
TGTACCGAAAACGCTTGCTTTGCTTTCTTGGGAAACTCTCTGCAATTCCTGGAGAAATCT
ACCATCATCATCTTAGCTTTGATTCTCTCTGAGTTTCTTCACTGTCAATTTCTGTTTCTG
CGTTTATCGATAAGAGAAATAAAATTCATCTGGCGGGGATTAAGCTTTTTTGGGGTGAGA
GATGGGTCAAACTTTTCGCAAGCTTTTCGATACCTTCTTCGGCAACCAGGAGATGAGGGT
ACTCTCCTTCTCTCCATCTTCTGTATTTGATTTCTGTATTTGATCGTTTACTGGACGGAA
TCGCGTGTTACCCATCGTTAATCGTTATACTCGCTTTCATTGTTTTGACGACACTCGGAT
TTTGAAATAATATGAAAAAGTGTTTGATTTGTGCTAATCATTGATGTATCCTGGGATTTA
TTATATGTTCAAAGAGTTACTTTTTAGGTCCGGTATATATGCTTGTAATCTAAACTCTTG
CTATGGGAT
GenBank Accession BX289124 [GenBank]
Graphic View Graphic view of gene At3g03120
Predicted Position of Insertion Chr3:717141 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T17B22
Hit Gene Code At3g03120 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ADP-ribosylation factor B1C
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23