SimpleSearch - Line and FST details


Line specific information

 
Line ID 423G08
Vector Used pAC161
Line Availability only available from NASC (N440592)
Segregation Analysis 50:50:39
Confirmed for Hit At3g58070
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g58070

 
Sequence (A. th genome BLAST matches underlined)
>63-K017809-022-423-G08-8409
TGATCTGANATTTCCCGGACTGAAGCCATTTACATTGAATATAAATACTCATTCGCCGTC
CTAAAGATAAGAACCCTAAACCCATTCGTGTCTTCGGAAAAGATTTCACCGGCAGAGATT
TCTCTATTACTACCGGTCAAGAAGACTACACCGATCCTTACCAGACCAAAAACAAAGAAG
AAGAAGAGGAAGAAGACCAAACCGGAGACAACAGTACGGACAATAATAGCATCAGCCACA
ACAGGAGATTCGAGTGTCACTATTGCTTTAGAAATTTTCCTACTTCACAAGCCCTATGGG
ATCTCCCTTAATAGTGAG
GenBank Accession BX289150 [GenBank]
Graphic View Graphic view of gene At3g58070
Predicted Position of Insertion Chr3:21507536 - go to primer design
BLAST e Value 2e-98
Hit Clone Code (BAC ID) T10K17
Hit Gene Code At3g58070 [TAIR] [MIPS] [SIGnAL]
Gene Annotation C2H2 and C2HC zinc fingers superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23