SimpleSearch - Line and FST details


Line specific information

 
Line ID 425D08
Vector Used pAC161
Line Availability only available from NASC (N440748)
Segregation Analysis 50:50:36
Confirmed for Hit F16D14
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F16D14

 
Sequence (A. th genome BLAST matches underlined)
>60-K017811-022-425-D08-8409
TATCCTGAAATTTCCCGGAATGAAGCCATTTACATTGAATATTGACCATCATGCTCAGTA
CACGATACCCGTAGCCCTGATGGGAGCCTTCTTCAATATCATGCAGGAAATGTCTTTTCT
CGAGGAGAAAGATGCTTGCATGATTCGATCTCGACTATGAGAAATGATCTAAAGGCCATG
GTGTAGCAAAAATGCAACGTGCCCGCTCTGACCGAGCTCTCCCTTGAACTCCGGCGGACC
AGCGAAACTTGACCTCGAGGTAAAGTTAAGTGATTCATTTGAGACTACCTGGAGACTCCA
TTATGCTCCGTGAACCGCACATTGTCGCACGAACTACCACACCCTGGGGAGATGTCTGAG
TCCTCAATTCCTTGAGTGAAACCACTCATGATGACCTTGGGAGCCTCGCTTGAAGCAACA
ACCTTTTCTTGCTGCATCATATGACAACCACGATCGTCTTGAGGGAACCTTCTCGAAGCT
TCTTCACTAAGTACAACCACTTGTGCTTGACAACTAACAACCTCAAGAACAAAGCCTCTG
AAGTCACTCTGTCACTACACTATGGGATCCTCCCTATTAAAAGCAAGACACCCTTAAGAA
CAAAGTCAGTGAAGTTACTTGTAAGTACACTATGGGA
GenBank Accession BX289341 [GenBank]
Graphic View Graphic view of sequence BX289341 of line 425D08
Predicted Position of Insertion Chr2:13353828 - go to primer design
BLAST e Value 9e-36
Hit Clone Code (BAC ID) F16D14
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23