SimpleSearch - Line and FST details


Line specific information

 
Line ID 428A06
Vector Used pAC161
Line Availability only available from NASC (N440998)
Segregation Analysis 60:60:52
Confirmed for Hit At1g08540
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g08540

 
Sequence (A. th genome BLAST matches underlined)
>41-K018077-022-428-A06-8409
TGATCTGTAGATTCCAGGACATGAGCATTTACAATTGATATATCCTGAGTATGATATATT
GCGCTATAGAGCACATACGCAACGATCTGGGATTCTACCACTAACCACTAATTTCGTCAT
TCTCAAACATCTAAAGATTTTGTAGACATCATTTTCGCCTATGGGATCCTCCCTATAGTG
AGAACCCTACGGGATCCTCCCTATTTTGCGTATGGGATCCTCCCTAGAGTGAGACGCCCC
GATATTAAA
GenBank Accession BX289561 [GenBank]
Graphic View Graphic view of gene At1g08540
Predicted Position of Insertion Chr1:2705294 - go to primer design
BLAST e Value 1e-34
Hit Clone Code (BAC ID) T27G7
Hit Gene Code At1g08540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RNApolymerase sigma subunit 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40