SimpleSearch - Line and FST details


Line specific information

 
Line ID 430C10
Vector Used pAC161
Line Availability available as T3 set from NASC (N441218)
Segregation Analysis 100:97:90
Confirmed for Hit At4g15765
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g15765

 
Sequence (A. th genome BLAST matches underlined) 
>75-K018170-022-430-C10-8409
GGACATGAGCATTTACAATTGATATATTTAGTTAAAATATAAATATTTATATACTTACTG
ATGAATTGGGAGAGACTTAAGACGAAGCTATGGGATCTTCCCTATAGTGAGATTTTTTCT
TGAGAGATCATTTTTGCTCTGGCTCTAGTTTGGCCTTGAGATTCATTGTCTGGTTTCTAT
GGGATCCTCCCTATAGTGAG
GenBank Accession BX289786 [GenBank]
Graphic View Graphic view of gene At4g15765
Predicted Position of Insertion Chr4:8976856 - go to primer design
BLAST e Value 2e-27
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g15765 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FAD/NAD(P)-binding oxidoreductase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX289786 [GenBank]


Last Updated on 10.06.2021 13:37