SimpleSearch - Line and FST details


Line specific information

 
Line ID 430D12
Vector Used pAC161
Line Availability only available from NASC (N441232)
Segregation Analysis 60:60:60
Confirmed for Hit At1g26790
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g26790

 
Sequence (A. th genome BLAST matches underlined)
>92-K018170-022-430-D12-8409
GAGCATTTTACATTGATATATACATGTAGTCTTTGTGCTATGGGATCCTACTTATAGTGA
GAGAAGACAGGTAACTGCTAAACCTATCGCACAGACGTCAGAGATCTATGGGATCCTCCC
TATAGCGAGATGATCTCTCTTTCAGTGCCACTACAAAGATTTGCCTCCTTTATTGTCAGC
CACGTCTCATTAAAATAGTACAACTTCTTTTGGAATATTCATACTCAACATTACAAATAC
TATAATGCTAAAACATTTACAAAAATGCCAGCTGCCATACATCAGTTCAAAATGCTATAT
TACAGATGTTCCAATGTGGTTTTGTGAATGAGTACTAAATATTTTGGTTTCTATACAAAT
AACCAACATATTGACTACTAAAAAAATTGTTGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX289797 [GenBank]
Graphic View Graphic view of gene At1g26790
Predicted Position of Insertion Chr1:9275264 - go to primer design
BLAST e Value 9e-110
Hit Clone Code (BAC ID) T24P13
Hit Gene Code At1g26790 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Dof-type zinc finger DNA-binding family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40