SimpleSearch - Line and FST details


Line specific information

 
Line ID 430F02
Vector Used pAC161
Line Availability only available from NASC (N441246)
Segregation Analysis 50:49:41
Confirmed for Hit At1g28560 At5g19620
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g28560

 
Sequence (A. th genome BLAST matches underlined)
>14-K018170-022-430-F02-8409
GATCATGAGATTTCCCGGACATGAAGCCATTTTACAATTGGTAATTTTTCTGTCATCTTC
ATTACCTCAGTATTCTTTAGTGTCCTCTTCTTTACCTCGGTATTCTTTACTGTCCTCTTC
CTTTTTGCCCTCCCAGCTAATGGATTTTCACTGCAGCATACCGAGAAGGTAACTGTTTGT
TATCGTTCTACAATTGTCTACGTCAACCATACTTTGTCTCTGGAAGATTTCTAATCATGA
CTAAGCTATTAACATATATATTGTCTACAAGACTTTCGAAATATATTGGGAGCTATGGGA
GenBank Accession BX289814 [GenBank]
Graphic View Graphic view of gene At1g28560
Predicted Position of Insertion Chr1:10039785 - go to primer design
BLAST e Value 5e-139
Hit Clone Code (BAC ID) F3M18
Hit Gene Code At1g28560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation snRNA activating complex family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g19620

 
Sequence (A. th genome BLAST matches underlined)
>14-K018148-022-430-F02-8409
TGATCTGAAATTTCCCGGACATGAAGCCATTTACTACTTAATATATACTGCTGCTCTTAC
ATATTCGATTCTCTACTCTTTTTACTCGGGATCTCTACTATATCAAGTGATTCAAGGGAT
CTCTCGAATCGCCGCACTCCTCCGACACTNTCGGTTCGGCGACCCAATTTACCGACTCAG
ATGCTCAATTCAGTAACCCAGCTTATGATTGGGAAGTCTTCTCCAATTTCATTGTCTCTT
ATCCAATCCACCCAATTCAATTGGTCTGAATCAAGAGATGAGAACGTTGAGACAATCCGT
GGACTAAGCTCGCCTCTGCTCTGTTGTGCCTCTTTGTCTCTAACTATGGGATCCTCCCTA
TAGTGAGACTATGGGATCCTCCCTATAGTGAGCCTATGGGATCCTCCNTATAGTGAGACA
AGAGAATACTGAATCGAGAGGAAAGTTTCGGGCCCAACTGGTTTTATTGCGGGACAGCTC
ATGATGTTCATATCGATCTATTATGCGCCTCTGCATTTAGCATTGGGTAGACCTCATACA
ATAACTGTCCTA
GenBank Accession BX289813 [GenBank]
Graphic View Graphic view of gene At5g19620
Predicted Position of Insertion Chr5:6623429 - go to primer design
BLAST e Value 1e-105
Hit Clone Code (BAC ID) T29J13
Hit Gene Code At5g19620 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation outer envelope protein of 80 kDa
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03