SimpleSearch - Line and FST details


Line specific information

 
Line ID 430G06
Vector Used pAC161
Line Availability only available from NASC (N441262)
Segregation Analysis 50:50:47
Confirmed for Hit At1g07570
Parent of DUPLO pair none
Parent of pair(s) 80, 6080, 6100, 6101, 6133, 6162, 10557, 10585, 74632, 74929, 74980, 75046, 75103, 75105, 75106, 75114, 75115
Note Although the line exists, the insertion in At5g53320 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g07570

 
Sequence (A. th genome BLAST matches underlined)
>47-K018148-022-430-G06-8409
TTTCCCGGACTGAAGCATTCATCAATTGAATATATGCCATCAATATACTCATTTCTTTTT
CTTCATTGGTGAAGGTGGATTCGGTTGTGTTTTCAAAGGATGGATTGATGAGAAGTCTCT
CACTGCCTCAAGACCAGGCACGGGTTTGGTTATTGCCGTCAAAAAGCTTAACCAAGATGG
TTGGCAAGGTCACCAGGAGTGGCTGGTAATAATGCTATAAGTTAAAATATGCCAATTTTG
GTTCTTGTTTGTTTTTCATTAATCTTCAGTTTTGATGATTTTGCAGGCTGAAGTGAATTA
CCTTGGTCAGTTTTCTCACCGTCACCTTGTGAAGCTGATTGGTTATTGCCTATGGG
GenBank Accession BX289835 [GenBank]
Graphic View Graphic view of gene At1g07570
Predicted Position of Insertion Chr1:2332770 - go to primer design
BLAST e Value 4e-161
Hit Clone Code (BAC ID) F22G5
Hit Gene Code At1g07570 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g53310

 
Sequence (A. th genome BLAST matches underlined)
>47-K018170-022-430-G06-8409
CCATCTCTCTCTGGAATTCGAGTGAATGGCGAAAACATGGCTATGGGATCCTCCCTATAG
TGAGATGGAATAGTCTTTCTTATNGTATATACGGAGATCCTGATAGACTTCCAATCGGAG
TTGTTGTCGCACCTGTGGAAACCTCTGATCTGTATCCGCTGGCTATAGGATCCTCCCTAT
AGTGAGA
GenBank Accession BX289836 [GenBank]
Graphic View Graphic view of gene At5g53310
Predicted Position of Insertion Chr5:21636324 - go to primer design
BLAST e Value 2e-49
Hit Clone Code (BAC ID) K19E1
Hit Gene Code At5g53310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myosin heavy chain-related
Insertion Classification TS2TE (3')
Confirmation Status failed


Last Updated on 07.07.2016 14:03