SimpleSearch - Line and FST details


Line specific information

 
Line ID 431G07
Vector Used pAC161
Line Availability only available from NASC (N441359)
Segregation Analysis 50:50:33
Confirmed for Hit At5g62470
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g62470

 
Sequence (A. th genome BLAST matches underlined)
>55-K018149-022-431-G07-8409
CATTTTCATATGTTTTCTAGCTATGATAATTATATCCTATTGGATCCGCCATCTAGTGAG
ACTACCGGCCAATGGTGATGGACTACCTATCTGCATACTCGCTATTAAGCAGAGGAAATT
TTACTGAGCATGAAGAGAAGACAATTGTTCATCTTCAAGCCCTTTTAGGCAACAGGTATA
TTTTAATGCACATGATCCATATTTTTCCAAAAAGTTACCTTTCTTGGGTATAAGATCTAA
ATATGTTTTTCTTTGTATATAGATGGGCAGCCATAGCATCATACCTTCCAGAAAGGACAG
ACAATGATATAAAGAACTATTGGAACACTCACTTGAAGAAGAAGCTCAAAAAGATTAATG
AATCTGGTGAAGAAGATAATGATGGTGTCTCTTCATCAAACACTATGGGATCCTCCCNAA
ATTGTGAGANNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCNCNNNNNNNNNNNNNNNANNNNNNNNNNNNNN
ANNAAAACNCGGCNCCCCCGCCAACACACCANANNACCCACAAAACAAAAACAAACAC
GenBank Accession BX289946 [GenBank]
Graphic View Graphic view of gene At5g62470
Predicted Position of Insertion Chr5:25080534 - go to primer design
BLAST e Value 4e-164
Hit Clone Code (BAC ID) K19B1
Hit Gene Code At5g62470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 96
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03