SimpleSearch - Line and FST details


Line specific information

 
Line ID 432C09
Vector Used pAC161
Line Availability only available from NASC (N441409)
Segregation Analysis 50:50:46
Confirmed for Hit At3g50750
Parent of DUPLO pair none
Parent of pair(s) 1328, 52569, 67498, 89393

Gene hit At1g16010

 
Sequence (A. th genome BLAST matches underlined)
>67-K018150-022-432-C09-8409
TGATCTGAAATTTCCCGGACATGAAGCCTTTACATTGAATATATGCTATCACGATCCACT
ATCCGACTCAAGAGGAGGTTTCATATGCTCTTAATTCTGATGTGCCTACACTTCTACACC
TACTATTATTGACGATATTGACAAAAAGGTGTTATATATGAAACTGAAGAGATGAACTTG
AAATTATGGATCTATTCCTCCTCCCAAAATGACAAATGCATTTGGTAGAAGATCTCTTGT
CAAAGAAATGATAGTTTCGTATGTGTACTGATCATAGACTCCATGATGTTCTAAAGAGAG
ATTACAATGAGATATTCCTTGGGATCCTCCTCATAGTGAGAGGATTTGATCTCCTAAGGA
TCCTCGGTATCTGAGCATGGTGAGACTAAGCTGGGAATCGAGAAACAAACAATCAGCTTC
AAGGGCTATTTCAAGAGCTCTAAACTCTAAAGGCAAATAATCAGGGGATGAATTCTCAAT
AGCATTGTCAAAACTCCTGCTCCTCCTCCTACTCAACTGGGAATTTTCCTGCTGCCACAT
CTCAACTACCTACTAGGGAATACTCCCTAATGGTAAGACCACAACGGAGGGGAAAAAGAT
AGATACGAAGGGAATTGGAAGACCACAGTTGAGGTCGCGGCAAAAAGGGAGACGGACCGA
GCCCTAGAGTAGACAAAATAAACAGGGGGGGGGGCAAAGGGAAGACAGCGCGGAAAAGAG
AGAAGAAATAAGCCGGAAAAAAAAAAAGAGCAAACACGGTAGGAAGGGCGGGGGAGAAAG
AAGATACAAAAGAGAG
GenBank Accession FR810142 [GenBank]
Graphic View Graphic view of gene At1g16010
Predicted Position of Insertion Chr1:5496160 - go to primer design
BLAST e Value 3e-69
Hit Clone Code (BAC ID) T24D18
Hit Gene Code At1g16010 [TAIR] [MIPS] [SIGnAL]
Gene Annotation magnesium transporter 2
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At3g50750

 
Sequence (A. th genome BLAST matches underlined)
>06-K118892-0022-432-C09C-oriL
ATTTTCATTGGATGTTGGTATCAATGATATACTCATTGGTAATTGTCGTGGTTTAACTAT
TTAGTCGGGTCCGGTACGAGATTGGTTCCGGTTAAATCGTAGCTAATAGATTGGTCTTTG
TCTTCATGACTATTTTGTACAGTCATTATCATTTATCAATGCTTCATTTCACAAAATCTA
GTATTTTTTTTTTTATATGTAAGGGGGGATAATGAAAAATGCAAGTGTGTGAAAGTGAAA
GTAACCACTCCCCATGTGATGATGGGGTCATGTAAATGTGATCTCTAACCACGCAGGATT
TTTCAATGTGCCTATCTTTATAAACACACCATTTTTAGGGGACCTGTAATTTTGATATTA
TCTTTTGAGAAATTGAATGAAAAACCCACAAAAAAACTATTTGAATCTTTCGTTGCGTGA
CTTGATCTTATTGTTGGACAATTCTGTTTTGCTATAAACATGACAAGTTGGTTGGTTCAT
GTGGTTTGAAACTTCTGTCCTTATACACTTTTAAAAGGAAATTTATAAAATTTTGAATGA
AACTGATATATTTGTAAAAGGCAGTATCATTAACCTTTTTGTTTTTTCGAAAATTGTTTG
TGTATGATGCACCGCCCTTTTTAGTTGTTGATTCGGGCTTAAATCTAATTTTCACATTTT
ATTTATTTTTCAGTCATAAATACGGATTTTATTTTAGCTTTTTCATAGGTTTACAAAAAT
TTAATTTTTAGTTTGGGTTTGTTACGTTTT
GenBank Accession HG968969 [GenBank]
Graphic View Graphic view of gene At3g50750
Predicted Position of Insertion Chr3:18862139 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T3A5
Hit Gene Code At3g50750 [TAIR] [MIPS] [SIGnAL]
Gene Annotation BES1/BZR1 homolog 1
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23