SimpleSearch - Line and FST details


Line specific information

 
Line ID 434E08
Vector Used pAC161
Line Availability only available from NASC (N441624)
Segregation Analysis 50:47:45
Confirmed for Hit At1g35515
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g35515

 
Sequence (A. th genome BLAST matches underlined)
>61-K018179-022-434-E08-8409
GATCATGANATTTCCNGGGACATGAGCATTTACAATTGATATATCCTGCAATTGAATATT
CAAGCCATTGTGATTAANNCGAGTTTACTCGGTAATTTTTCCAATTTTCCAGCTATGGGA
TCTNCCNTATAGTGAGAGAAATTTACCAACGGATTTAGGAAGAGAACGCCAAGAGCCTTC
ACCATGATCACGTATATAATCAATAAGACGTTGATCTTCTTCTTTAGTCCATGCTCCTTT
GTTCATGTGAGCCTTTTCACAACATGGTGATCTTCCCATGATGATGGTTACATGTGTGGG
TGATGAGACAAGAAGAGTGAGGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX290223 [GenBank]
Graphic View Graphic view of gene At1g35515
Predicted Position of Insertion Chr1:13078146 - go to primer design
BLAST e Value 2e-98
Hit Clone Code (BAC ID) F15O4
Hit Gene Code At1g35515 [TAIR] [MIPS] [SIGnAL]
Gene Annotation high response to osmotic stress 10
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g07856

 
Sequence (A. th genome BLAST matches underlined)
>61-K018189-022-434-E08-8409
CCGTTTAGATCAGGACGAAGGAATTAATCCATCTTAATCTAAACTTTTTCCACAACGCAA
CAACCCTAAAGAAAAGATAAAATCATCAGATCAAGAAACATAAAAATTTGAAAGAAAAAA
AATCAAAACTTTGGAGAAATTTACCAACGGATTTAGGAAGAGAACGCCAAGAGCCTTCAC
CATGATTACGTATATAATCAATAAGACGTTGATCTTCTTCTTTAGTCCATGCTCCTTTGT
TCATGTGAGCCTTTTCACAACATGGTGATCTTCCCATGATGATGGTTACATGTGTGGGTG
ATGAGACAAGAAGAGTGAGACTATGGGATCCTCCCTTATAGTGAGAGGCGGAGTGTGACT
GCCAGGAGGAGGCAGGCGGATATGTCTTGGGCAGATTTCATGGCCGAGTTTAATGCGAAG
TACTTTCCGCAGGAGGCGTTCGACCTTATGGAAGCTCGTTTTCTTGAGCTAAGACAGGGT
GAGCGGTCAGTTCGGGTGTATGACCGGGATTTTAACCGACTTTTGGTGTATGCGGGTCGG
GGCATGGAGGATGACCAGGCCTATGGGATC
GenBank Accession BX290224 [GenBank]
Graphic View Graphic view of gene At4g07856
Predicted Position of Insertion Chr4:4682556 - go to primer design
BLAST e Value 2e-119
Hit Clone Code (BAC ID) F5K24
Hit Gene Code At4g07856 [TAIR] [MIPS] [SIGnAL]
Gene Annotation transposable element gene
Insertion Classification TS2TE
Confirmation Status unknown


Last Updated on 14.10.2014 10:23