SimpleSearch - Line and FST details


Line specific information

 
Line ID 435A11
Vector Used pAC161
Line Availability not available
Segregation Analysis unknown
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit T7D17

 
Sequence (A. th genome BLAST matches underlined)
>81-K018180-022-435-A11-8409
ATAGTGAGAAGCAATGGAACCATCTCAAGCAACTCTTTGATAGCAAATCTATGGGATCCT
CCCTATAGTGAGAA
GenBank Accession BX290284 [GenBank]
Graphic View Graphic view of sequence BX290284 of line 435A11
Predicted Position of Insertion Chr2:16979731 - go to primer design
BLAST e Value 2e-15
Hit Clone Code (BAC ID) T7D17
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 10.06.2021 13:37