SimpleSearch - Line and FST details


Line specific information

 
Line ID 435D07
Vector Used pAC161
Line Availability only available from NASC (N441707)
Segregation Analysis 50:10:7
Confirmed for Hit At3g15850
Parent of DUPLO pair none
Parent of pair(s) 4086, 83540

Gene hit At3g13930

 
Sequence (A. th genome BLAST matches underlined)
>52-K018190-022-435-D07-8409
TGATCTGANATTTCCCGGAATGAAGCCTTTACAATTGAATATATCCTGAATGGCTTGACA
TGTAGAACTCACCAAGAGTCAGAAGAACGGTAAATCGCAGTATAGAGAGTGAAGGATCAC
TTGGAAGAAAGCTGGGATTTGATGATGATGATGAAGATAGTTTTGTGTTTAGGTTTTTCA
GAAATGGCAAAATGCTGCCTTACATGTACCAGATTGTATCGTACCAACACCAATTCTACC
ATAACCGATATAAAAGTATTTAAACCGACTAATTAAGCTTCACAAATTTCGGTTTGTACT
TTATTATATTGGGCCCTATTATTATTCTCTGAGCTTTTGCGTCTCACCAAAAGACAGAGA
TCATCAGGTGCGTTAGTGATTACGTAGGCATCTAATGAACGGCAGGGATTAGTCAAACTT
ATTAATGGGCCTAATCTTTGGCCCATCGTTTTCCCTCGATTCCTGTCACACAAAAAACTC
CTATGGGAT
GenBank Accession BX290325 [GenBank]
Graphic View Graphic view of gene At3g13930
Predicted Position of Insertion Chr3:4596048 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MDC16
Hit Gene Code At3g13930 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Dihydrolipoamide acetyltransferase, long form protein
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit At3g15850

 
Sequence (A. th genome BLAST matches underlined)
>52-K018180-022-435-D07-8409
TTTTCTCATTTTTCTTGGTGTGCTAAGGTCAATAATCTAAGTTGCACTATATTACAAGAA
AACGCAAGAGGGAAATCAAGTGAGGAGATTTGGCCCAGCAAATTGATAGCTACACAAAAA
AAACCGGTAGAATTATCTTGTTTTGGCCGAGCTAAAACACATCATAATCCTATCAGCTAT
GGG
GenBank Accession BX290324 [GenBank]
Graphic View Graphic view of gene At3g15850
Predicted Position of Insertion Chr3:5360284 - go to primer design
BLAST e Value 2e-64
Hit Clone Code (BAC ID) MSJ11
Hit Gene Code At3g15850 [TAIR] [MIPS] [SIGnAL]
Gene Annotation fatty acid desaturase 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23