SimpleSearch - Line and FST details


Line specific information

 
Line ID 436D05
Vector Used pAC161
Line Availability only available from NASC (N441801)
Segregation Analysis 50:48:46
Confirmed for Hit At1g09560
Parent of DUPLO pair none
Parent of pair(s) 4805, 7426, 7440, 10095, 11271, 93160, 93180, 93201, 93236, 93254, 93271, 93312, 93334, 93351, 93360, 93368, 93375, 93388

Gene hit At1g09560

 
Sequence (A. th genome BLAST matches underlined)
>36-K018181-022-436-D05-8409
GCTATAGTGAGCTCCCTATAGTGAGATGTGACTGTAGCTGCGTCTTTGCAAGGGAAGCCA
TTGATTTTGATTCCTGCAAAAAAGAAAAAGAAGAAAGAGATTAGAAATTGAATCTTTTTC
TATGGGATCCTCCCTATAGTGAGAGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAA
TTCAAAAATGTAAATGTCCGCAGCGTTATTATAAGGGAAAGGGAGG
GenBank Accession BX290429 [GenBank]
Graphic View Graphic view of gene At1g09560
Predicted Position of Insertion Chr1:3094184 - go to primer design
BLAST e Value 2e-21
Hit Clone Code (BAC ID) F14J9
Hit Gene Code At1g09560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation germin-like protein 5
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g35830

 
Sequence (A. th genome BLAST matches underlined)
>36-K018191-022-436-D05-8409
ATGAAGCATTTACATTGACTAAGGCACCGAATGTGTTGTTGGTAAGACCTGGTTTAGCTA
ATCCTTGTGAGAAGAAATCGGCTGATGTGACTGTAGCTGCGTCTTTGCAAGGGAAGCCAT
TGATTTTGATTCCTGCAAAAAAGAAAAACAAGAAAGAGATTAGAAATTGAATCTTTTCCT
ATGGGATCCTCCCTATAGTGAGANTGGNGTGAAAGACGCATACTGTTTACTCAATTTTGG
AGACAGTATTACCACTGATCACATCTCACCAGCTGGTAGCATCCACAAGGACAGTCCTGC
GGCTAAGTACTTGATGGAACGAGGTGTGGATAGAAGAGACTTCAACTCATACGGGAGTCG
CCGTGGTAATGATGAGATTATGGCGAGAGGCACTTTTGCAAATATCCGGATTGTCAACAA
ACACTTGAAAGGAGAAGTTGGTCCCAAAACAGTTCACATTCCCACTGGAGAGAAACTTTC
TGTTTTCGATGCTGCCGTGGAATAATCTCACTTTTTTTTTTATCCTTTTGGAAA
GenBank Accession BX290430 [GenBank]
Graphic View Graphic view of gene At4g35830
Predicted Position of Insertion Chr4:16974400 - go to primer design
BLAST e Value 1e-161
Hit Clone Code (BAC ID) F4B14
Hit Gene Code At4g35830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation aconitase 1
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03