SimpleSearch - Line and FST details


Line specific information

 
Line ID 439H04
Vector Used pAC161
Line Availability only available from NASC (N442136)
Segregation Analysis 50:49:49
Confirmed for Hit At3g18890
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g18890

 
Sequence (A. th genome BLAST matches underlined)
>32-K018215-022-439-H04-8409
ATGAGCATTCACTCTTACTTACTCTATGGGATGCCTCTCTTATAGAGAGATTTCAAGCTT
TTTGATTACACTACTTCTGCATCTTTTGGTTTGACTTTGTTTGCTTTTCGTGAAATGGGA
CTTTGCTCGAACGTGATTCGCTTCTTCTCTTAACACTTTATCTGTGTCTTGTTTTTGCTG
ATGGTTTCTGCAATGTTGTCGTTTCCCAAGTCTTTAATTCTATGTGATACTCTCCTCATC
TGTAGAACCTTTTGATCACACACCATTACTCTCGTTATAATATTTGGCGCCTGAAGCGCT
ATGGGATCCTCCCTATAGTGAG
GenBank Accession BX290780 [GenBank]
Graphic View Graphic view of gene At3g18890
Predicted Position of Insertion Chr3:6511349 - go to primer design
BLAST e Value 5e-99
Hit Clone Code (BAC ID) MCB22
Hit Gene Code At3g18890 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD(P)-binding Rossmann-fold superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40